Incidental Mutation 'R1935:Abca4'
ID215891
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission 039953-MU
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1935 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122052923 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 30 (V30M)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
Predicted Effect probably benign
Transcript: ENSMUST00000013995
AA Change: V30M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: V30M

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132199
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 intron probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 intron probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7944:Abca4 UTSW 3 122069248 intron probably null
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGCCACTGTGAGATATGTGATCTG -3'
(R):5'- AGAGTTTGTACAGCACTGGGG -3'

Sequencing Primer
(F):5'- ATGTGATCTGTGGTGAAGTGTTACC -3'
(R):5'- GGAACCTGGTTTATACATTGCAGCC -3'
Posted On2014-07-14