Incidental Mutation 'R1935:Crocc'
ID215896
Institutional Source Beutler Lab
Gene Symbol Crocc
Ensembl Gene ENSMUSG00000040860
Gene Nameciliary rootlet coiled-coil, rootletin
Synonyms
MMRRC Submission 039953-MU
Accession Numbers

Genbank: NM_172122;MGI: 3529431

Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1935 (G1)
Quality Score202
Status Validated
Chromosome4
Chromosomal Location141016637-141060550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141034058 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 755 (R755G)
Ref Sequence ENSEMBL: ENSMUSP00000126543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000168157]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040222
AA Change: R755G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860
AA Change: R755G

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097816
AA Change: R755G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860
AA Change: R755G

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102491
AA Change: R919G

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860
AA Change: R919G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151455
Predicted Effect possibly damaging
Transcript: ENSMUST00000168157
AA Change: R755G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860
AA Change: R755G

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show no apparent functional deficits in phototransduction and ciliary beating in sensory and motile cilia. However, photoreceptors degenerate over time, and lungs appear prone to pathological changes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Crocc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Crocc APN 4 141022112 missense probably damaging 1.00
IGL01474:Crocc APN 4 141035392 splice site probably benign
IGL01859:Crocc APN 4 141029290 missense probably benign 0.07
IGL02161:Crocc APN 4 141033991 missense probably benign 0.01
IGL02244:Crocc APN 4 141037920 missense probably benign 0.00
IGL02970:Crocc APN 4 141030246 missense possibly damaging 0.49
N/A:Crocc UTSW 4 141021746 missense probably damaging 1.00
R0158:Crocc UTSW 4 141042242 splice site probably benign
R0280:Crocc UTSW 4 141028426 missense probably damaging 1.00
R0448:Crocc UTSW 4 141042191 missense probably damaging 1.00
R0532:Crocc UTSW 4 141030247 missense possibly damaging 0.95
R0597:Crocc UTSW 4 141019913 missense probably benign 0.06
R0597:Crocc UTSW 4 141017071 missense probably benign
R0761:Crocc UTSW 4 141029776 missense probably benign 0.00
R0761:Crocc UTSW 4 141047076 missense probably benign 0.01
R1238:Crocc UTSW 4 141035364 missense probably benign 0.00
R1460:Crocc UTSW 4 141029240 nonsense probably null
R1515:Crocc UTSW 4 141019737 missense probably benign 0.00
R1557:Crocc UTSW 4 141025465 missense probably damaging 0.96
R1561:Crocc UTSW 4 141030268 missense probably damaging 1.00
R1641:Crocc UTSW 4 141017077 missense probably benign 0.00
R1709:Crocc UTSW 4 141026099 critical splice donor site probably null
R1785:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1786:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1793:Crocc UTSW 4 141019309 missense probably damaging 1.00
R1897:Crocc UTSW 4 141018736 missense probably damaging 1.00
R2037:Crocc UTSW 4 141046942 critical splice donor site probably null
R2127:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2129:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2130:Crocc UTSW 4 141029102 missense probably benign 0.04
R2136:Crocc UTSW 4 141032954 missense probably damaging 1.00
R2298:Crocc UTSW 4 141025459 missense probably benign 0.30
R2847:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2848:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2913:Crocc UTSW 4 141020350 missense probably damaging 1.00
R3415:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3416:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3417:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R4082:Crocc UTSW 4 141033971 splice site probably null
R4454:Crocc UTSW 4 141020405 missense possibly damaging 0.52
R4591:Crocc UTSW 4 141018672 missense probably damaging 1.00
R4597:Crocc UTSW 4 141019777 missense probably damaging 1.00
R4984:Crocc UTSW 4 141034452 missense probably damaging 1.00
R4992:Crocc UTSW 4 141046666 missense probably damaging 0.98
R5109:Crocc UTSW 4 141028411 missense probably damaging 1.00
R5143:Crocc UTSW 4 141041039 missense probably benign 0.01
R5381:Crocc UTSW 4 141029311 missense possibly damaging 0.95
R5684:Crocc UTSW 4 141051144 missense probably damaging 0.99
R5757:Crocc UTSW 4 141043564 missense probably damaging 1.00
R5795:Crocc UTSW 4 141041807 frame shift probably null
R5796:Crocc UTSW 4 141041807 frame shift probably null
R5798:Crocc UTSW 4 141041807 frame shift probably null
R5815:Crocc UTSW 4 141035196 missense probably damaging 0.99
R5955:Crocc UTSW 4 141017918 missense possibly damaging 0.75
R6031:Crocc UTSW 4 141034357 critical splice donor site probably null
R6063:Crocc UTSW 4 141041721 missense probably benign 0.08
R6063:Crocc UTSW 4 141046540 missense probably damaging 1.00
R7086:Crocc UTSW 4 141047057 missense possibly damaging 0.47
R7282:Crocc UTSW 4 141022341 missense probably damaging 1.00
R7293:Crocc UTSW 4 141043556 missense probably benign 0.17
R7404:Crocc UTSW 4 141026186 missense possibly damaging 0.46
R7571:Crocc UTSW 4 141046049 critical splice acceptor site probably null
R7646:Crocc UTSW 4 141021655 missense probably null 0.94
R7782:Crocc UTSW 4 141025286 missense probably benign 0.05
R8053:Crocc UTSW 4 141042919 critical splice donor site probably null
X0065:Crocc UTSW 4 141041792 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- ATGTGACAGCCCTGGATAAGG -3'
(R):5'- AGTTACTTAAGAGCCTGGCTTACC -3'

Sequencing Primer
(F):5'- CTGGATAAGGAACCCAGGCC -3'
(R):5'- GGCTTACCAATGCCACCTCG -3'
Posted On2014-07-14