Incidental Mutation 'R0129:Adcy8'
ID 21592
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Name adenylate cyclase 8
Synonyms AC8
MMRRC Submission 038414-MU
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R0129 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 15
Chromosomal Location 64697084-64922296 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64747013 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 764 (C764R)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
AlphaFold P97490
Predicted Effect probably benign
Transcript: ENSMUST00000023007
AA Change: C764R

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: C764R

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228014
AA Change: C764R

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.3155 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 splice site probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64921033 missense probably benign
R7644:Adcy8 UTSW 15 64699369 missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64747001 missense probably benign
R7735:Adcy8 UTSW 15 64783780 missense probably benign 0.10
R7789:Adcy8 UTSW 15 64871774 nonsense probably null
R7860:Adcy8 UTSW 15 64699473 missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64920205 missense possibly damaging 0.60
R7948:Adcy8 UTSW 15 64815350 missense possibly damaging 0.80
R7966:Adcy8 UTSW 15 64702090 missense probably damaging 1.00
R8024:Adcy8 UTSW 15 64920246 missense probably damaging 1.00
R8097:Adcy8 UTSW 15 64871862 splice site probably null
R8158:Adcy8 UTSW 15 64783806 missense probably benign 0.32
R8463:Adcy8 UTSW 15 64921025 missense probably benign
R8474:Adcy8 UTSW 15 64704789 missense probably damaging 0.98
R8696:Adcy8 UTSW 15 64815386 missense probably benign 0.30
R8955:Adcy8 UTSW 15 64704705 missense possibly damaging 0.92
R8973:Adcy8 UTSW 15 64699135 makesense probably null
R9015:Adcy8 UTSW 15 64725357 intron probably benign
R9041:Adcy8 UTSW 15 64737438 missense probably benign 0.31
R9052:Adcy8 UTSW 15 64920915 missense probably benign 0.00
R9074:Adcy8 UTSW 15 64702091 missense probably damaging 0.96
R9183:Adcy8 UTSW 15 64822267 missense probably damaging 0.98
R9259:Adcy8 UTSW 15 64704755 missense probably damaging 1.00
R9498:Adcy8 UTSW 15 64920196 missense possibly damaging 0.88
R9522:Adcy8 UTSW 15 64920711 missense probably damaging 0.99
R9800:Adcy8 UTSW 15 64699246 missense probably benign 0.19
Z1176:Adcy8 UTSW 15 64725518 missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64699177 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCATGGGTCATGGAGTCAGAC -3'
(R):5'- AAGATTTCCAGGGCCATTGGGTG -3'

Sequencing Primer
(F):5'- tgcatggcacatagcagg -3'
(R):5'- GCCATTGGGTGGGGATG -3'
Posted On 2013-04-11