Incidental Mutation 'R0129:Dmc1'
ID21593
Institutional Source Beutler Lab
Gene Symbol Dmc1
Ensembl Gene ENSMUSG00000022429
Gene NameDNA meiotic recombinase 1
SynonymsDmc1h, sgdp, Dmc1, Mei11
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R0129 (G1)
Quality Score211
Status Validated
Chromosome15
Chromosomal Location79561497-79605109 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 79596240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023065] [ENSMUST00000229408] [ENSMUST00000230011]
Predicted Effect probably benign
Transcript: ENSMUST00000023065
SMART Domains Protein: ENSMUSP00000023065
Gene: ENSMUSG00000022429

DomainStartEndE-ValueType
HhH1 57 76 8.07e0 SMART
AAA 118 307 2.79e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175482
Predicted Effect probably benign
Transcript: ENSMUST00000229408
Predicted Effect probably benign
Transcript: ENSMUST00000230011
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. In mouse, deficiency of this gene causes infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations are sterile with failure of homologous pairing in meiotic prophase in males and disrupted oogenesis in embryonic females with absence of germ cells in the adult ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Dmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Dmc1 APN 15 79596280 missense probably benign 0.11
IGL02817:Dmc1 APN 15 79588763 missense probably damaging 1.00
IGL03131:Dmc1 APN 15 79568691 missense probably benign 0.02
IGL03341:Dmc1 APN 15 79562545 missense probably benign 0.01
R0395:Dmc1 UTSW 15 79588772 missense probably damaging 1.00
R0908:Dmc1 UTSW 15 79585689 missense probably damaging 1.00
R2219:Dmc1 UTSW 15 79585126 missense possibly damaging 0.77
R3706:Dmc1 UTSW 15 79562581 missense probably damaging 1.00
R6362:Dmc1 UTSW 15 79588823 missense probably benign 0.42
R7499:Dmc1 UTSW 15 79602420 nonsense probably null
R7619:Dmc1 UTSW 15 79596242 critical splice donor site probably null
R8270:Dmc1 UTSW 15 79601545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCTGGAATTTGCCTCAC -3'
(R):5'- AGGTTTCTGCCCATGTTCTGATACAC -3'

Sequencing Primer
(F):5'- gttcaaatcccagcaaccac -3'
(R):5'- CCATGTTCTGATACACTCTTCAAAG -3'
Posted On2013-04-11