Incidental Mutation 'R1935:Slc17a8'
ID215930
Institutional Source Beutler Lab
Gene Symbol Slc17a8
Ensembl Gene ENSMUSG00000019935
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
SynonymsVglut3
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1935 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89574020-89621253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89577915 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 484 (M484V)
Ref Sequence ENSEMBL: ENSMUSP00000020102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020102] [ENSMUST00000105295]
Predicted Effect probably benign
Transcript: ENSMUST00000020102
AA Change: M484V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020102
Gene: ENSMUSG00000019935
AA Change: M484V

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
internal_repeat_1 62 77 3.74e-7 PROSPERO
internal_repeat_1 75 90 3.74e-7 PROSPERO
Pfam:MFS_1 95 478 1e-46 PFAM
transmembrane domain 493 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105295
AA Change: M300V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100932
Gene: ENSMUSG00000019935
AA Change: M300V

DomainStartEndE-ValueType
Pfam:MFS_1 1 294 1.1e-34 PFAM
transmembrane domain 309 331 N/A INTRINSIC
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a vesicular glutamate transporter. The encoded protein transports the neurotransmitter glutamate into synaptic vesicles before it is released into the synaptic cleft. Mutations in this gene are the cause of autosomal-dominant nonsyndromic type 25 deafness. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sensorineural hearing loss, cochlear ganglion degeneration, decreased synaptic glutamate release, and nonconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Slc17a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Slc17a8 APN 10 89591295 missense possibly damaging 0.70
IGL00990:Slc17a8 APN 10 89576530 missense probably benign 0.01
IGL01317:Slc17a8 APN 10 89620804 missense probably benign 0.02
IGL01339:Slc17a8 APN 10 89591244 missense probably damaging 1.00
IGL01468:Slc17a8 APN 10 89592021 critical splice donor site probably null
IGL02401:Slc17a8 APN 10 89576660 splice site probably null
IGL02638:Slc17a8 APN 10 89576603 nonsense probably null
IGL02859:Slc17a8 APN 10 89576584 missense probably benign 0.11
R0518:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0521:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0610:Slc17a8 UTSW 10 89576626 missense probably damaging 0.99
R0846:Slc17a8 UTSW 10 89606734 missense possibly damaging 0.81
R0928:Slc17a8 UTSW 10 89598683 missense probably damaging 1.00
R1277:Slc17a8 UTSW 10 89597457 missense possibly damaging 0.80
R1401:Slc17a8 UTSW 10 89591214 missense probably damaging 1.00
R1854:Slc17a8 UTSW 10 89606765 missense unknown
R1936:Slc17a8 UTSW 10 89577915 missense probably benign 0.03
R3887:Slc17a8 UTSW 10 89591138 splice site probably benign
R4227:Slc17a8 UTSW 10 89598713 missense probably damaging 1.00
R4872:Slc17a8 UTSW 10 89576505 missense probably benign 0.38
R5023:Slc17a8 UTSW 10 89576560 missense probably benign 0.01
R5330:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5331:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5576:Slc17a8 UTSW 10 89597502 missense probably damaging 1.00
R5593:Slc17a8 UTSW 10 89606840 missense probably benign
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R7038:Slc17a8 UTSW 10 89600221 missense probably benign 0.00
R7220:Slc17a8 UTSW 10 89576413 missense probably benign
R7514:Slc17a8 UTSW 10 89592107 missense probably damaging 1.00
R7574:Slc17a8 UTSW 10 89592146 missense probably benign 0.01
R7689:Slc17a8 UTSW 10 89597457 missense possibly damaging 0.80
R8145:Slc17a8 UTSW 10 89576371 missense probably benign 0.00
R8693:Slc17a8 UTSW 10 89592896 missense probably benign 0.08
R8857:Slc17a8 UTSW 10 89591160 missense probably damaging 1.00
X0021:Slc17a8 UTSW 10 89598682 missense probably damaging 1.00
X0067:Slc17a8 UTSW 10 89592912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATTAGTCTCACTGCCATCGG -3'
(R):5'- TGCTGGGAGATGCCACATTG -3'

Sequencing Primer
(F):5'- CTGCCATCGGTAACCAGTGAAG -3'
(R):5'- TGGAAGGCCAAGTTCGATTC -3'
Posted On2014-07-14