Mutagenetix > Incidental Mutation

Incidental Mutation 'R0129:Espl1'

21594

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

038414-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0129 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102316648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1431 (T1431A)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: T1431A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: T1431A

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: T1431A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Meta Mutation Damage Score

0.0609

Coding Region Coverage

1x: 99.1%
3x: 97.7%
10x: 92.2%
20x: 74.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa2	A	G	18: 74,787,194	D31G	probably damaging	Het
Actr2	A	G	11: 20,100,939		probably benign	Het
Adcy8	A	G	15: 64,747,013	C764R	probably benign	Het
Ago4	A	C	4: 126,517,183	F171C	possibly damaging	Het
Akt2	T	C	7: 27,636,970	F408S	probably damaging	Het
Ankrd24	T	C	10: 81,638,329	L26P	probably damaging	Het
Appl1	A	T	14: 26,928,643	M524K	probably damaging	Het
Arhgef11	T	A	3: 87,728,063	I922N	probably damaging	Het
Atp5h	T	C	11: 115,417,918	E47G	probably damaging	Het
Birc6	A	G	17: 74,528,760	D70G	probably benign	Het
Bola2	G	A	7: 126,696,559	V56M	probably damaging	Het
Ccdc151	G	T	9: 21,993,552	R313S	probably damaging	Het
Cd300lg	A	G	11: 102,054,092		probably null	Het
Cdc42bpb	A	G	12: 111,304,959		probably benign	Het
Ceacam20	A	G	7: 19,976,260	N403S	probably damaging	Het
Cenpf	T	C	1: 189,659,650	M662V	probably benign	Het
Chd3	C	A	11: 69,348,501	E1607*	probably null	Het
Chtf18	A	T	17: 25,727,311	Y9*	probably null	Het
Clta	A	G	4: 44,032,424	N200S	probably benign	Het
Csmd1	G	A	8: 16,079,942	S1722F	possibly damaging	Het
Dennd4a	T	C	9: 64,893,294	S905P	probably damaging	Het
Dhx57	T	C	17: 80,238,914	K1347R	probably damaging	Het
Dmc1	A	T	15: 79,596,240		probably benign	Het
Dnhd1	G	T	7: 105,720,924	A4519S	probably benign	Het
Dnmbp	A	G	19: 43,850,027	C1120R	probably benign	Het
Efs	C	T	14: 54,917,223	A427T	probably damaging	Het
Erich6	T	C	3: 58,624,378	E399G	probably damaging	Het
Fam184b	A	G	5: 45,532,778	S830P	probably damaging	Het
Fam49a	C	T	12: 12,362,349	T204I	probably damaging	Het
Herc1	T	A	9: 66,448,075	C2203S	probably damaging	Het
Itpr1	G	A	6: 108,349,676	V120M	probably damaging	Het
Kcnh7	G	A	2: 62,716,159	T1026I	probably benign	Het
Kif1b	A	G	4: 149,261,201	I394T	probably benign	Het
Ldlrap1	A	C	4: 134,757,422	V87G	probably damaging	Het
Lgals12	C	T	19: 7,603,038	V155I	probably damaging	Het
Limch1	A	T	5: 66,959,590	N116I	probably damaging	Het
Lonp2	C	T	8: 86,634,890	R232C	probably damaging	Het
Lrch1	C	A	14: 74,835,746	C151F	probably benign	Het
Lrig3	A	G	10: 126,006,943	Y579C	probably damaging	Het
Macf1	T	C	4: 123,433,275	S4808G	probably damaging	Het
Mapkap1	A	T	2: 34,623,482	K501N	probably damaging	Het
Mdc1	G	T	17: 35,854,445	R1523L	probably benign	Het
Mlh3	C	T	12: 85,266,140		probably benign	Het
Mul1	T	C	4: 138,437,721		probably benign	Het
Mybl2	G	A	2: 163,059,491		probably benign	Het
Notch1	G	C	2: 26,460,458	H2223Q	probably benign	Het
Notch2	C	A	3: 98,146,620	L2200M	probably benign	Het
Olfr1329	A	T	4: 118,917,470		probably null	Het
Olfr160	T	C	9: 37,711,940	Y113C	probably damaging	Het
Olfr291	T	A	7: 84,856,988	F206L	probably benign	Het
Olfr358	G	A	2: 37,005,045	R190*	probably null	Het
Plekhs1	T	C	19: 56,477,290		probably null	Het
Ppm1h	G	A	10: 122,941,355	G509R	probably damaging	Het
Ppp2r3c	C	T	12: 55,298,422	E94K	probably damaging	Het
Ppp2r5e	T	A	12: 75,462,390	I372F	probably damaging	Het
Ptprt	G	A	2: 162,278,070	T159I	probably benign	Het
Rab20	A	G	8: 11,454,415	F95S	probably damaging	Het
Rfc3	A	C	5: 151,651,151	M1R	probably null	Het
Skp2	A	G	15: 9,125,193	S100P	probably damaging	Het
Smg5	T	C	3: 88,349,233	S269P	probably benign	Het
Sspo	A	T	6: 48,455,418	T684S	probably benign	Het
Syt3	A	G	7: 44,393,358	K355E	probably damaging	Het
Tcp10a	A	T	17: 7,343,504	K355N	probably damaging	Het
Tnrc18	A	G	5: 142,765,045		probably benign	Het
Tsfm	A	G	10: 127,030,470	L74P	probably benign	Het
Ttn	G	C	2: 76,734,265	N28509K	probably damaging	Het
Ube2l6	G	A	2: 84,798,908	M1I	probably null	Het
Vmn2r80	T	A	10: 79,169,496	H322Q	probably damaging	Het
Zkscan8	A	T	13: 21,522,271	S212T	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTTCCTCTTGCAAACTGAGACC -3'
(R):5'- ACTGGCTCCTCTTCAGGGATACTTC -3'

Sequencing Primer
(F):5'- GGGAAGTCAGTTCTGACCTCATC -3'
(R):5'- CAGGGATACTTCTCATGATCTCGG -3'

Posted On

2013-04-11