Incidental Mutation 'R1935:Recql5'
ID215940
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R1935 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115897191 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 434 (Y434C)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131566] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000142089] [ENSMUST00000152171] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: Y434C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: Y434C

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131566
Predicted Effect probably benign
Transcript: ENSMUST00000131578
AA Change: T214A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752
AA Change: T214A

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142089
SMART Domains Protein: ENSMUSP00000138928
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147172
Predicted Effect probably benign
Transcript: ENSMUST00000152171
SMART Domains Protein: ENSMUSP00000139148
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCCTGGCTAGTACAGTG -3'
(R):5'- ACGCCCTGTGGATAAAAGGG -3'

Sequencing Primer
(F):5'- CCTGGCTAGTACAGTGGAATGAC -3'
(R):5'- AAGTTCCAGGTGATCTGACACTC -3'
Posted On2014-07-14