Incidental Mutation 'R1935:Paip1'
ID215948
Institutional Source Beutler Lab
Gene Symbol Paip1
Ensembl Gene ENSMUSG00000025451
Gene Namepolyadenylate binding protein-interacting protein 1
Synonyms
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R1935 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location119428601-119458218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119457014 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 463 (M463K)
Ref Sequence ENSEMBL: ENSMUSP00000117256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026520] [ENSMUST00000109203] [ENSMUST00000126957] [ENSMUST00000173627] [ENSMUST00000174533]
Predicted Effect probably damaging
Transcript: ENSMUST00000026520
AA Change: M379K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026520
Gene: ENSMUSG00000025451
AA Change: M379K

DomainStartEndE-ValueType
Pfam:PAM2 44 61 8.9e-8 PFAM
MIF4G 80 297 2.62e-46 SMART
low complexity region 373 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109203
AA Change: M346K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104826
Gene: ENSMUSG00000025451
AA Change: M346K

DomainStartEndE-ValueType
Pfam:PAM2 11 28 3.7e-7 PFAM
MIF4G 47 264 2.62e-46 SMART
low complexity region 340 352 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126957
AA Change: M463K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117256
Gene: ENSMUSG00000025451
AA Change: M463K

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 3.3e-7 PFAM
MIF4G 164 381 2.62e-46 SMART
low complexity region 457 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132304
SMART Domains Protein: ENSMUSP00000134617
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 6.8e-5 PFAM
Pfam:MIF4G 164 267 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173627
AA Change: W348R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134051
Gene: ENSMUSG00000025451
AA Change: W348R

DomainStartEndE-ValueType
Pfam:PAM2 44 61 3.6e-7 PFAM
MIF4G 80 297 2.62e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174533
AA Change: M188K

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134365
Gene: ENSMUSG00000025451
AA Change: M188K

DomainStartEndE-ValueType
Pfam:MIF4G 49 106 1.4e-8 PFAM
Meta Mutation Damage Score 0.1402 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Paip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02668:Paip1 APN 13 119438071 missense probably damaging 1.00
IGL02873:Paip1 APN 13 119445812 missense possibly damaging 0.95
R0517:Paip1 UTSW 13 119447790 missense probably damaging 1.00
R0791:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R0792:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R1419:Paip1 UTSW 13 119457017 missense probably damaging 0.99
R1572:Paip1 UTSW 13 119451784 unclassified probably benign
R1936:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R2072:Paip1 UTSW 13 119430262 missense possibly damaging 0.88
R3827:Paip1 UTSW 13 119430232 start codon destroyed probably null 0.47
R4082:Paip1 UTSW 13 119457004 missense probably damaging 1.00
R4092:Paip1 UTSW 13 119449913 missense probably benign 0.02
R4854:Paip1 UTSW 13 119449889 splice site probably benign
R5012:Paip1 UTSW 13 119447802 missense probably benign
R5103:Paip1 UTSW 13 119437979 missense possibly damaging 0.95
R5425:Paip1 UTSW 13 119430166 missense possibly damaging 0.60
R5592:Paip1 UTSW 13 119450798 missense probably damaging 1.00
R5851:Paip1 UTSW 13 119440765 missense possibly damaging 0.94
R5929:Paip1 UTSW 13 119445790 missense probably damaging 1.00
R5976:Paip1 UTSW 13 119456997 missense probably damaging 1.00
R6021:Paip1 UTSW 13 119457135 frame shift probably null
R6326:Paip1 UTSW 13 119430217 missense probably benign 0.00
R6964:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7544:Paip1 UTSW 13 119445801 missense probably damaging 1.00
R7552:Paip1 UTSW 13 119440820 missense possibly damaging 0.83
R7659:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7660:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7661:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7984:Paip1 UTSW 13 119430162 nonsense probably null
R8294:Paip1 UTSW 13 119450764 missense possibly damaging 0.95
Z1177:Paip1 UTSW 13 119447808 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTAGGCATAACCACTGGAAGG -3'
(R):5'- GGTATAAGTCTGACACAGTTTCTTGC -3'

Sequencing Primer
(F):5'- CTGGAAGGATAAAACTTTTTGAGTGG -3'
(R):5'- AAGTCTGACACAGTTTCTTGCTTTCC -3'
Posted On2014-07-14