Mutagenetix > Incidental Mutations

Incidental Mutation 'R1935:Dnah8'

215954

Institutional Source

Beutler Lab

Gene Symbol

Dnah8

Ensembl Gene

ENSMUSG00000033826

Gene Name

dynein, axonemal, heavy chain 8

Synonyms

Dnahc8, P1-Loop, Hst6.7b

MMRRC Submission

039953-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.348) question?

Stock #

R1935 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30624354-30875264 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 30726896 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170651]

Predicted Effect

probably benign
Transcript: ENSMUST00000170651

SMART Domains

Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826

Domain	Start	End	E-Value	Type
low complexity region	2	54	N/A	INTRINSIC
Pfam:DHC_N1	379	936	8.4e-159	PFAM
low complexity region	1069	1080	N/A	INTRINSIC
low complexity region	1224	1237	N/A	INTRINSIC
Pfam:DHC_N2	1509	1917	1.6e-134	PFAM
AAA	2082	2226	1.38e-1	SMART
AAA	2363	2516	2.04e-1	SMART
AAA	2689	2837	8.15e-2	SMART
Pfam:AAA_8	3022	3294	4e-72	PFAM
Pfam:MT	3306	3656	3.6e-48	PFAM
Pfam:AAA_9	3676	3901	6.7e-85	PFAM
Pfam:Dynein_heavy	4039	4728	8.4e-250	PFAM

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.6%

Validation Efficiency

95% (95/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,052,923	V30M	probably benign	Het
Abcg8	C	T	17: 84,694,989		probably benign	Het
Ablim1	T	A	19: 57,215,965		probably null	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adgrf3	A	T	5: 30,202,306	N207K	probably benign	Het
Anapc4	T	A	5: 52,839,668	D94E	probably damaging	Het
Arfgef2	A	G	2: 166,863,603	N918S	probably benign	Het
Arhgap45	A	G	10: 80,030,954	N1097S	probably damaging	Het
Atf2	G	A	2: 73,846,219	P184S	probably damaging	Het
Atg2a	A	G	19: 6,252,536	Y963C	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Atrn	T	C	2: 130,958,035	V444A	probably damaging	Het
Avpr1a	G	A	10: 122,449,790		probably null	Het
Best3	A	C	10: 117,024,386	Q517P	probably benign	Het
C3	A	G	17: 57,218,829	L851P	probably damaging	Het
Cacna2d2	T	C	9: 107,509,256	F194S	probably damaging	Het
Carns1	T	C	19: 4,165,474	E903G	probably damaging	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Ciao1	A	G	2: 127,246,460	S148P	possibly damaging	Het
Clrn3	A	C	7: 135,514,024	I199S	possibly damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Cnot2	G	C	10: 116,498,415	P274R	possibly damaging	Het
Cops7a	G	A	6: 124,962,396	R97*	probably null	Het
Coro7	T	C	16: 4,628,732	E843G	probably benign	Het
Crocc	T	C	4: 141,034,058	R755G	possibly damaging	Het
Crtam	G	C	9: 41,004,550	P13A	probably benign	Het
Ddrgk1	G	T	2: 130,663,560		probably benign	Het
Defb26	T	A	2: 152,508,275	K28N	possibly damaging	Het
Dnhd1	A	T	7: 105,673,976	M564L	probably benign	Het
Dusp15	A	G	2: 152,945,421		probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eapp	A	T	12: 54,673,728	M234K	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Gfi1b	T	C	2: 28,610,113	K302R	possibly damaging	Het
Gpatch1	A	G	7: 35,295,522	S440P	probably damaging	Het
Gpr6	T	C	10: 41,071,481	E35G	probably benign	Het
H2-Q1	A	T	17: 35,323,493	M305L	probably benign	Het
Hoxa10	C	A	6: 52,234,370	G189C	possibly damaging	Het
Kbtbd4	T	C	2: 90,907,551	V215A	probably damaging	Het
Klf16	G	A	10: 80,576,905	A99V	probably benign	Het
Lvrn	A	T	18: 46,878,320	Y448F	probably benign	Het
Med19	A	G	2: 84,685,658	H177R	possibly damaging	Het
Mif	G	T	10: 75,859,847	H41N	possibly damaging	Het
Mpl	A	G	4: 118,455,739	M132T	probably benign	Het
Mtcl1	G	T	17: 66,379,414	H480Q	probably benign	Het
Myo18b	T	C	5: 112,760,356	N2017S	probably benign	Het
Neurl4	C	T	11: 69,907,133	R740C	probably damaging	Het
Nlgn1	G	T	3: 26,331,790		probably benign	Het
Olfr1206	A	C	2: 88,865,180	M192L	probably benign	Het
Olfr128	T	A	17: 37,924,102	C179S	probably damaging	Het
Olfr319	T	A	11: 58,702,346	L215Q	probably damaging	Het
Olfr807	A	G	10: 129,754,715	V245A	probably damaging	Het
Paip1	T	A	13: 119,457,014	M463K	probably damaging	Het
Parp3	T	A	9: 106,474,732	Y147F	probably damaging	Het
Pgrmc2	C	A	3: 41,083,038		probably benign	Het
Phldb3	G	A	7: 24,617,407	A278T	probably benign	Het
Plxnb1	T	C	9: 109,095,647		probably null	Het
Pom121	G	A	5: 135,383,886	R481C	unknown	Het
Psg22	A	T	7: 18,719,710	N149I	probably damaging	Het
Recql5	T	C	11: 115,897,191	Y434C	probably benign	Het
Rexo1	A	G	10: 80,550,469	S252P	probably benign	Het
Rtl1	A	G	12: 109,591,920	S1162P	probably benign	Het
Samd9l	G	T	6: 3,376,269	Q331K	probably benign	Het
Sipa1l1	T	C	12: 82,372,434	Y629H	probably damaging	Het
Slc12a2	A	T	18: 57,904,353	I512L	possibly damaging	Het
Slc17a8	T	C	10: 89,577,915	M484V	probably benign	Het
Slc25a24	A	T	3: 109,136,265	E79D	probably damaging	Het
Snw1	T	A	12: 87,459,477	I218F	probably damaging	Het
Sorcs1	T	C	19: 50,232,644	D545G	probably damaging	Het
Sorcs2	A	G	5: 36,071,387	S104P	possibly damaging	Het
Spry4	A	G	18: 38,590,089	I207T	possibly damaging	Het
Tex101	A	G	7: 24,668,225	V234A	probably benign	Het
Thra	T	A	11: 98,763,073		probably benign	Het
Tmem161b	T	A	13: 84,293,466	L210Q	probably damaging	Het
Tmem50a	A	G	4: 134,903,642		probably benign	Het
Tmem63b	A	G	17: 45,678,961		probably null	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Trdmt1	A	G	2: 13,511,609	L386P	probably damaging	Het
Trip12	T	C	1: 84,794,101	S109G	possibly damaging	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttn	T	A	2: 76,747,178	D24457V	probably damaging	Het
Ttn	A	C	2: 76,885,490		probably benign	Het
Tubgcp4	A	T	2: 121,178,666		probably benign	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Vps72	T	A	3: 95,122,540	V290D	probably benign	Het
Zfp408	A	T	2: 91,649,748	M1K	probably null	Het
Zfy2	C	A	Y: 2,121,496	M132I	probably benign	Het

Other mutations in Dnah8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Dnah8	APN	17	30677176	missense	probably benign	0.06
IGL00508:Dnah8	APN	17	30855930	missense	probably damaging	1.00
IGL00547:Dnah8	APN	17	30815703	nonsense	probably null
IGL00551:Dnah8	APN	17	30663478	nonsense	probably null
IGL00732:Dnah8	APN	17	30656641	missense	probably damaging	1.00
IGL00775:Dnah8	APN	17	30767906	nonsense	probably null
IGL00840:Dnah8	APN	17	30790941	missense	probably damaging	1.00
IGL00845:Dnah8	APN	17	30819276	critical splice donor site	probably null
IGL00953:Dnah8	APN	17	30706457	nonsense	probably null
IGL00976:Dnah8	APN	17	30851710	missense	probably damaging	0.98
IGL01395:Dnah8	APN	17	30636005	missense	probably benign	0.06
IGL01467:Dnah8	APN	17	30779916	missense	probably damaging	1.00
IGL01469:Dnah8	APN	17	30683714	splice site	probably benign
IGL01515:Dnah8	APN	17	30648485	missense	probably benign
IGL01723:Dnah8	APN	17	30708471	missense	probably damaging	1.00
IGL01837:Dnah8	APN	17	30751591	critical splice donor site	probably null
IGL01921:Dnah8	APN	17	30736141	missense	probably benign
IGL01958:Dnah8	APN	17	30855895	splice site	probably benign
IGL01968:Dnah8	APN	17	30656598	nonsense	probably null
IGL02093:Dnah8	APN	17	30717880	missense	probably damaging	0.99
IGL02151:Dnah8	APN	17	30648417	missense	possibly damaging	0.50
IGL02182:Dnah8	APN	17	30794763	missense	possibly damaging	0.45
IGL02233:Dnah8	APN	17	30706513	critical splice donor site	probably null
IGL02236:Dnah8	APN	17	30649773	nonsense	probably null
IGL02259:Dnah8	APN	17	30759614	missense	probably benign
IGL02263:Dnah8	APN	17	30729165	missense	probably benign	0.00
IGL02303:Dnah8	APN	17	30713047	missense	probably benign	0.03
IGL02341:Dnah8	APN	17	30747257	missense	probably damaging	1.00
IGL02351:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02358:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02377:Dnah8	APN	17	30794796	missense	probably damaging	0.98
IGL02390:Dnah8	APN	17	30830845	missense	probably benign	0.01
IGL02392:Dnah8	APN	17	30818051	splice site	probably benign
IGL02414:Dnah8	APN	17	30700413	missense	probably benign
IGL02455:Dnah8	APN	17	30672334	missense	probably damaging	0.99
IGL02817:Dnah8	APN	17	30668295	missense	probably benign
IGL02831:Dnah8	APN	17	30712276	missense	probably benign	0.23
IGL02863:Dnah8	APN	17	30769697	missense	probably damaging	1.00
IGL02894:Dnah8	APN	17	30721110	nonsense	probably null
IGL02954:Dnah8	APN	17	30704835	missense	probably benign	0.30
IGL02964:Dnah8	APN	17	30746761	missense	probably damaging	1.00
IGL03080:Dnah8	APN	17	30719006	missense	probably benign	0.01
IGL03081:Dnah8	APN	17	30686373	splice site	probably benign
IGL03086:Dnah8	APN	17	30742780	missense	probably damaging	1.00
IGL03087:Dnah8	APN	17	30784144	missense	probably benign
IGL03176:Dnah8	APN	17	30694037	missense	probably benign
IGL03191:Dnah8	APN	17	30726830	missense	probably damaging	0.99
IGL03210:Dnah8	APN	17	30815665	missense	probably damaging	0.96
IGL03252:Dnah8	APN	17	30673920	splice site	probably null
IGL03255:Dnah8	APN	17	30741381	missense	probably damaging	1.00
IGL03288:Dnah8	APN	17	30672349	missense	probably benign
IGL03348:Dnah8	APN	17	30746986	missense	probably damaging	0.99
Alternator	UTSW	17	30765635	missense	probably benign
armature	UTSW	17	30708390	missense	probably benign	0.02
Brush	UTSW	17	30746990	missense	probably damaging	1.00
Dynos	UTSW	17	30715509	missense	possibly damaging	0.84
joule	UTSW	17	30713098	critical splice donor site	probably null
solenoid	UTSW	17	30741178	missense	probably damaging	1.00
FR4340:Dnah8	UTSW	17	30635463	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635465	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635477	small deletion	probably benign
I2288:Dnah8	UTSW	17	30663454	missense	probably benign
P0029:Dnah8	UTSW	17	30765720	missense	probably damaging	1.00
PIT4812001:Dnah8	UTSW	17	30708445	missense	probably benign	0.04
R0016:Dnah8	UTSW	17	30663316	missense	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0087:Dnah8	UTSW	17	30755119	missense	probably damaging	1.00
R0090:Dnah8	UTSW	17	30784090	missense	probably benign	0.20
R0119:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0184:Dnah8	UTSW	17	30683683	missense	probably benign	0.04
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0265:Dnah8	UTSW	17	30690271	missense	probably benign
R0268:Dnah8	UTSW	17	30769707	missense	probably damaging	1.00
R0282:Dnah8	UTSW	17	30736156	missense	probably damaging	1.00
R0299:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0334:Dnah8	UTSW	17	30871351	missense	probably damaging	0.99
R0393:Dnah8	UTSW	17	30708390	missense	probably benign	0.02
R0423:Dnah8	UTSW	17	30701981	missense	probably benign
R0470:Dnah8	UTSW	17	30708540	splice site	probably benign
R0477:Dnah8	UTSW	17	30755080	missense	probably damaging	1.00
R0490:Dnah8	UTSW	17	30700419	missense	probably benign
R0499:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0582:Dnah8	UTSW	17	30718961	missense	probably benign	0.01
R0601:Dnah8	UTSW	17	30708358	missense	probably benign	0.06
R0646:Dnah8	UTSW	17	30684173	missense	probably damaging	0.97
R0665:Dnah8	UTSW	17	30736155	missense	probably damaging	0.99
R0800:Dnah8	UTSW	17	30704662	missense	probably benign
R0843:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R0940:Dnah8	UTSW	17	30803243	missense	probably damaging	1.00
R0964:Dnah8	UTSW	17	30673920	splice site	probably null
R1102:Dnah8	UTSW	17	30854764	splice site	probably null
R1137:Dnah8	UTSW	17	30855936	missense	probably damaging	1.00
R1342:Dnah8	UTSW	17	30721000	missense	probably damaging	0.99
R1375:Dnah8	UTSW	17	30737295	missense	probably damaging	1.00
R1377:Dnah8	UTSW	17	30840622	nonsense	probably null
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1497:Dnah8	UTSW	17	30752075	missense	probably damaging	1.00
R1513:Dnah8	UTSW	17	30673888	missense	probably benign
R1541:Dnah8	UTSW	17	30747247	missense	probably damaging	1.00
R1563:Dnah8	UTSW	17	30635664	missense	probably benign	0.07
R1634:Dnah8	UTSW	17	30713098	critical splice donor site	probably null
R1670:Dnah8	UTSW	17	30725124	missense	probably damaging	1.00
R1710:Dnah8	UTSW	17	30854940	missense	probably damaging	1.00
R1743:Dnah8	UTSW	17	30769651	missense	probably benign	0.28
R1761:Dnah8	UTSW	17	30779916	missense	probably damaging	1.00
R1785:Dnah8	UTSW	17	30722937	missense	probably damaging	0.98
R1804:Dnah8	UTSW	17	30708407	missense	probably benign	0.00
R1808:Dnah8	UTSW	17	30684186	missense	probably damaging	1.00
R1824:Dnah8	UTSW	17	30731180	missense	possibly damaging	0.67
R1836:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R1935:Dnah8	UTSW	17	30635505	missense	unknown
R1940:Dnah8	UTSW	17	30731207	missense	probably damaging	1.00
R1946:Dnah8	UTSW	17	30712385	missense	probably benign	0.00
R2025:Dnah8	UTSW	17	30731159	missense	probably damaging	0.99
R2038:Dnah8	UTSW	17	30758281	missense	probably damaging	1.00
R2042:Dnah8	UTSW	17	30635658	missense	probably benign	0.01
R2148:Dnah8	UTSW	17	30737258	missense	probably damaging	1.00
R2177:Dnah8	UTSW	17	30653393	missense	probably benign
R2180:Dnah8	UTSW	17	30840647	missense	probably benign	0.00
R2262:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2263:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2328:Dnah8	UTSW	17	30794744	missense	probably damaging	1.00
R2357:Dnah8	UTSW	17	30771872	missense	probably benign
R2357:Dnah8	UTSW	17	30874935	missense	probably benign	0.00
R2360:Dnah8	UTSW	17	30677204	missense	probably benign	0.22
R2496:Dnah8	UTSW	17	30851731	missense	probably damaging	1.00
R2497:Dnah8	UTSW	17	30741365	nonsense	probably null
R2509:Dnah8	UTSW	17	30775045	missense	probably benign	0.02
R3114:Dnah8	UTSW	17	30833568	missense	probably benign	0.04
R3708:Dnah8	UTSW	17	30739657	missense	probably damaging	0.98
R3720:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3722:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3727:Dnah8	UTSW	17	30739648	nonsense	probably null
R3747:Dnah8	UTSW	17	30784174	nonsense	probably null
R3748:Dnah8	UTSW	17	30784174	nonsense	probably null
R3749:Dnah8	UTSW	17	30784174	nonsense	probably null
R3787:Dnah8	UTSW	17	30755041	missense	probably damaging	1.00
R3790:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3804:Dnah8	UTSW	17	30670647	missense	probably benign	0.00
R3857:Dnah8	UTSW	17	30663422	missense	probably damaging	0.96
R3898:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3899:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3938:Dnah8	UTSW	17	30854937	missense	probably damaging	1.00
R3943:Dnah8	UTSW	17	30694065	splice site	probably benign
R4091:Dnah8	UTSW	17	30769839	missense	probably damaging	1.00
R4291:Dnah8	UTSW	17	30748559	missense	probably benign
R4326:Dnah8	UTSW	17	30752092	missense	probably benign	0.04
R4346:Dnah8	UTSW	17	30725098	missense	possibly damaging	0.92
R4429:Dnah8	UTSW	17	30752146	missense	probably damaging	1.00
R4457:Dnah8	UTSW	17	30813151	missense	probably benign
R4475:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4565:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4566:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4568:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4573:Dnah8	UTSW	17	30700406	missense	probably benign	0.00
R4580:Dnah8	UTSW	17	30662052	missense	probably benign	0.00
R4585:Dnah8	UTSW	17	30751567	missense	probably benign	0.01
R4611:Dnah8	UTSW	17	30684237	missense	probably damaging	1.00
R4720:Dnah8	UTSW	17	30683634	missense	probably benign	0.08
R4721:Dnah8	UTSW	17	30725166	missense	probably damaging	1.00
R4727:Dnah8	UTSW	17	30851747	missense	probably damaging	1.00
R4731:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4732:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4733:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4798:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4814:Dnah8	UTSW	17	30767924	missense	probably damaging	1.00
R4892:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4894:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4900:Dnah8	UTSW	17	30746975	missense	probably damaging	1.00
R4901:Dnah8	UTSW	17	30840714	critical splice donor site	probably null
R4913:Dnah8	UTSW	17	30819139	missense	probably damaging	0.99
R4931:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4932:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4933:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4942:Dnah8	UTSW	17	30729142	missense	probably benign
R4969:Dnah8	UTSW	17	30723014	missense	probably damaging	1.00
R4975:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4977:Dnah8	UTSW	17	30663301	missense	probably benign	0.00
R5001:Dnah8	UTSW	17	30787185	missense	probably damaging	1.00
R5011:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5013:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5014:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5024:Dnah8	UTSW	17	30736096	missense	probably damaging	1.00
R5075:Dnah8	UTSW	17	30739757	critical splice donor site	probably null
R5075:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5075:Dnah8	UTSW	17	30800531	missense	probably damaging	1.00
R5112:Dnah8	UTSW	17	30731038	missense	probably benign	0.02
R5121:Dnah8	UTSW	17	30810353	missense	probably benign	0.14
R5138:Dnah8	UTSW	17	30765597	missense	probably damaging	0.99
R5151:Dnah8	UTSW	17	30712295	missense	probably benign	0.06
R5191:Dnah8	UTSW	17	30746765	missense	probably damaging	1.00
R5238:Dnah8	UTSW	17	30790917	missense	probably damaging	1.00
R5260:Dnah8	UTSW	17	30700419	missense	probably benign
R5358:Dnah8	UTSW	17	30746954	missense	probably damaging	1.00
R5403:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5404:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5482:Dnah8	UTSW	17	30800547	missense	probably damaging	0.96
R5489:Dnah8	UTSW	17	30790956	missense	probably damaging	1.00
R5513:Dnah8	UTSW	17	30752916	missense	probably damaging	0.99
R5635:Dnah8	UTSW	17	30706386	missense	probably benign	0.00
R5640:Dnah8	UTSW	17	30803108	missense	probably damaging	1.00
R5649:Dnah8	UTSW	17	30800587	missense	probably benign	0.13
R5662:Dnah8	UTSW	17	30737333	missense	probably damaging	1.00
R5673:Dnah8	UTSW	17	30803261	missense	probably damaging	1.00
R5677:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5699:Dnah8	UTSW	17	30810324	missense	probably benign	0.22
R5737:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5738:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5739:Dnah8	UTSW	17	30719007	missense	probably benign	0.00
R5766:Dnah8	UTSW	17	30690261	missense	probably benign	0.01
R5790:Dnah8	UTSW	17	30875004	missense	probably damaging	0.98
R5848:Dnah8	UTSW	17	30728191	missense	possibly damaging	0.69
R5854:Dnah8	UTSW	17	30794763	missense	possibly damaging	0.45
R5885:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5886:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5887:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5899:Dnah8	UTSW	17	30656685	missense	probably benign	0.32
R5979:Dnah8	UTSW	17	30815664	nonsense	probably null
R5986:Dnah8	UTSW	17	30851630	missense	possibly damaging	0.83
R5999:Dnah8	UTSW	17	30663305	missense	probably benign	0.32
R6042:Dnah8	UTSW	17	30747265	missense	probably damaging	1.00
R6175:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6181:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6237:Dnah8	UTSW	17	30747854	nonsense	probably null
R6239:Dnah8	UTSW	17	30810359	missense	probably damaging	0.99
R6337:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6365:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6416:Dnah8	UTSW	17	30765635	missense	probably benign
R6443:Dnah8	UTSW	17	30771885	missense	probably benign	0.10
R6478:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6479:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6480:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6481:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6533:Dnah8	UTSW	17	30746990	missense	probably damaging	1.00
R6606:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6608:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6610:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6675:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6723:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6724:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6754:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6755:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6759:Dnah8	UTSW	17	30663292	splice site	probably null
R6765:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6766:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6778:Dnah8	UTSW	17	30635666	missense	probably benign	0.00
R6781:Dnah8	UTSW	17	30765724	frame shift	probably null
R6788:Dnah8	UTSW	17	30648465	missense	probably benign	0.14
R6814:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6825:Dnah8	UTSW	17	30741173	missense	probably damaging	1.00
R6838:Dnah8	UTSW	17	30710551	missense	probably damaging	1.00
R6872:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6877:Dnah8	UTSW	17	30746959	missense	probably damaging	1.00
R6944:Dnah8	UTSW	17	30794659	missense	probably benign	0.09
R6982:Dnah8	UTSW	17	30767925	missense	probably benign	0.03
R6984:Dnah8	UTSW	17	30739738	missense	probably damaging	1.00
R6987:Dnah8	UTSW	17	30662091	missense	possibly damaging	0.95
R6988:Dnah8	UTSW	17	30643275	missense	probably damaging	1.00
R7099:Dnah8	UTSW	17	30704724	missense	possibly damaging	0.93
R7106:Dnah8	UTSW	17	30741178	missense	probably damaging	1.00
R7112:Dnah8	UTSW	17	30871392	missense	possibly damaging	0.79
R7146:Dnah8	UTSW	17	30644617	missense	probably benign	0.01
R7146:Dnah8	UTSW	17	30769644	missense	possibly damaging	0.90
R7309:Dnah8	UTSW	17	30875014	missense	probably damaging	1.00
R7324:Dnah8	UTSW	17	30784125	missense	probably benign	0.01
R7373:Dnah8	UTSW	17	30767965	critical splice donor site	probably null
R7423:Dnah8	UTSW	17	30704769	missense	possibly damaging	0.86
R7430:Dnah8	UTSW	17	30706389	missense	probably damaging	0.98
R7450:Dnah8	UTSW	17	30787191	missense	probably damaging	0.99
R7580:Dnah8	UTSW	17	30775103	missense	probably damaging	0.98
R7604:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R7635:Dnah8	UTSW	17	30785107	missense	probably damaging	1.00
R7646:Dnah8	UTSW	17	30649677	missense	probably benign	0.00
R7685:Dnah8	UTSW	17	30657973	missense	probably damaging	1.00
R7793:Dnah8	UTSW	17	30855944	missense	probably benign	0.20
R7827:Dnah8	UTSW	17	30760867	frame shift	probably null
R7866:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R7877:Dnah8	UTSW	17	30663374	missense	probably benign
R7891:Dnah8	UTSW	17	30712289	missense	probably benign	0.09
R7977:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R7987:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R8025:Dnah8	UTSW	17	30741337	nonsense	probably null
R8076:Dnah8	UTSW	17	30784153	missense	possibly damaging	0.94
R8170:Dnah8	UTSW	17	30673823	missense	probably damaging	1.00
R8199:Dnah8	UTSW	17	30871419	missense	probably benign	0.06
R8253:Dnah8	UTSW	17	30760867	frame shift	probably null
R8270:Dnah8	UTSW	17	30840713	missense	probably damaging	1.00
R8291:Dnah8	UTSW	17	30765727	missense	probably damaging	1.00
R8334:Dnah8	UTSW	17	30769831	missense	probably benign	0.12
R8348:Dnah8	UTSW	17	30673840	missense	probably benign
R8348:Dnah8	UTSW	17	30736147	missense	probably damaging	0.96
R8354:Dnah8	UTSW	17	30643260	missense	probably benign	0.17
R8355:Dnah8	UTSW	17	30695178	missense	possibly damaging	0.89
R8439:Dnah8	UTSW	17	30760867	frame shift	probably null
R8448:Dnah8	UTSW	17	30673840	missense	probably benign
R8459:Dnah8	UTSW	17	30725247	critical splice donor site	probably null
R8462:Dnah8	UTSW	17	30656629	missense	probably damaging	1.00
R8506:Dnah8	UTSW	17	30721134	missense	probably benign
R8524:Dnah8	UTSW	17	30715498	missense	possibly damaging	0.95
R8555:Dnah8	UTSW	17	30721110	nonsense	probably null
R8698:Dnah8	UTSW	17	30875035	missense	probably damaging	1.00
R8719:Dnah8	UTSW	17	30741315	missense	probably damaging	0.97
R8778:Dnah8	UTSW	17	30760867	frame shift	probably null
R8781:Dnah8	UTSW	17	30725104	missense	probably damaging	1.00
R8794:Dnah8	UTSW	17	30760867	frame shift	probably null
R8805:Dnah8	UTSW	17	30760867	frame shift	probably null
R8821:Dnah8	UTSW	17	30794738	missense	probably damaging	1.00
R8864:Dnah8	UTSW	17	30762642	missense	possibly damaging	0.95
R8885:Dnah8	UTSW	17	30708312	missense	possibly damaging	0.83
R8983:Dnah8	UTSW	17	30851654	missense	probably damaging	0.98
R8994:Dnah8	UTSW	17	30790833	missense	probably benign	0.05
RF027:Dnah8	UTSW	17	30635476	frame shift	probably null
X0001:Dnah8	UTSW	17	30748680	missense	probably damaging	1.00
X0013:Dnah8	UTSW	17	30819186	missense	possibly damaging	0.71
Z1176:Dnah8	UTSW	17	30648540	missense	probably benign
Z1177:Dnah8	UTSW	17	30694033	missense	probably benign
Z1177:Dnah8	UTSW	17	30713095	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGAGAAACGCCTGTTGG -3'
(R):5'- TTTTGTAGGTAAGTATGCACGC -3'

Sequencing Primer
(F):5'- GCTATTCTCTCCTTGGCCAAAAC -3'
(R):5'- GGTGCTGGAATTCACTGAATCAACC -3'

Posted On

2014-07-14