Incidental Mutation 'R0129:Mdc1'
ID 21596
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Name mediator of DNA damage checkpoint 1
Synonyms NFBD1
MMRRC Submission 038414-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R0129 (G1)
Quality Score 202
Status Validated (trace)
Chromosome 17
Chromosomal Location 36152407-36170562 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 36165337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1523 (R1523L)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: R1523L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: R1523L

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,920,265 (GRCm39) D31G probably damaging Het
Actr2 A G 11: 20,050,939 (GRCm39) probably benign Het
Adcy8 A G 15: 64,618,862 (GRCm39) C764R probably benign Het
Ago4 A C 4: 126,410,976 (GRCm39) F171C possibly damaging Het
Akt2 T C 7: 27,336,395 (GRCm39) F408S probably damaging Het
Ankrd24 T C 10: 81,474,163 (GRCm39) L26P probably damaging Het
Appl1 A T 14: 26,650,600 (GRCm39) M524K probably damaging Het
Arhgef11 T A 3: 87,635,370 (GRCm39) I922N probably damaging Het
Atp5pd T C 11: 115,308,744 (GRCm39) E47G probably damaging Het
Birc6 A G 17: 74,835,755 (GRCm39) D70G probably benign Het
Bola2 G A 7: 126,295,731 (GRCm39) V56M probably damaging Het
Cd300lg A G 11: 101,944,918 (GRCm39) probably null Het
Cdc42bpb A G 12: 111,271,393 (GRCm39) probably benign Het
Ceacam20 A G 7: 19,710,185 (GRCm39) N403S probably damaging Het
Cenpf T C 1: 189,391,847 (GRCm39) M662V probably benign Het
Chd3 C A 11: 69,239,327 (GRCm39) E1607* probably null Het
Chtf18 A T 17: 25,946,285 (GRCm39) Y9* probably null Het
Clta A G 4: 44,032,424 (GRCm39) N200S probably benign Het
Csmd1 G A 8: 16,129,956 (GRCm39) S1722F possibly damaging Het
Cyria C T 12: 12,412,350 (GRCm39) T204I probably damaging Het
Dennd4a T C 9: 64,800,576 (GRCm39) S905P probably damaging Het
Dhx57 T C 17: 80,546,343 (GRCm39) K1347R probably damaging Het
Dmc1 A T 15: 79,480,441 (GRCm39) probably benign Het
Dnhd1 G T 7: 105,370,131 (GRCm39) A4519S probably benign Het
Dnmbp A G 19: 43,838,466 (GRCm39) C1120R probably benign Het
Efs C T 14: 55,154,680 (GRCm39) A427T probably damaging Het
Erich6 T C 3: 58,531,799 (GRCm39) E399G probably damaging Het
Espl1 A G 15: 102,225,083 (GRCm39) T1431A probably benign Het
Fam184b A G 5: 45,690,120 (GRCm39) S830P probably damaging Het
Herc1 T A 9: 66,355,357 (GRCm39) C2203S probably damaging Het
Itpr1 G A 6: 108,326,637 (GRCm39) V120M probably damaging Het
Kcnh7 G A 2: 62,546,503 (GRCm39) T1026I probably benign Het
Kif1b A G 4: 149,345,658 (GRCm39) I394T probably benign Het
Ldlrap1 A C 4: 134,484,733 (GRCm39) V87G probably damaging Het
Lgals12 C T 19: 7,580,403 (GRCm39) V155I probably damaging Het
Limch1 A T 5: 67,116,933 (GRCm39) N116I probably damaging Het
Lonp2 C T 8: 87,361,518 (GRCm39) R232C probably damaging Het
Lrch1 C A 14: 75,073,186 (GRCm39) C151F probably benign Het
Lrig3 A G 10: 125,842,812 (GRCm39) Y579C probably damaging Het
Macf1 T C 4: 123,327,068 (GRCm39) S4808G probably damaging Het
Mapkap1 A T 2: 34,513,494 (GRCm39) K501N probably damaging Het
Mlh3 C T 12: 85,312,914 (GRCm39) probably benign Het
Mul1 T C 4: 138,165,032 (GRCm39) probably benign Het
Mybl2 G A 2: 162,901,411 (GRCm39) probably benign Het
Notch1 G C 2: 26,350,470 (GRCm39) H2223Q probably benign Het
Notch2 C A 3: 98,053,936 (GRCm39) L2200M probably benign Het
Odad3 G T 9: 21,904,848 (GRCm39) R313S probably damaging Het
Or10ak8 A T 4: 118,774,667 (GRCm39) probably null Het
Or12k5 G A 2: 36,895,057 (GRCm39) R190* probably null Het
Or5ae2 T A 7: 84,506,196 (GRCm39) F206L probably benign Het
Or8a1b T C 9: 37,623,236 (GRCm39) Y113C probably damaging Het
Plekhs1 T C 19: 56,465,722 (GRCm39) probably null Het
Ppm1h G A 10: 122,777,260 (GRCm39) G509R probably damaging Het
Ppp2r3c C T 12: 55,345,207 (GRCm39) E94K probably damaging Het
Ppp2r5e T A 12: 75,509,164 (GRCm39) I372F probably damaging Het
Ptprt G A 2: 162,119,990 (GRCm39) T159I probably benign Het
Rab20 A G 8: 11,504,415 (GRCm39) F95S probably damaging Het
Rfc3 A C 5: 151,574,616 (GRCm39) M1R probably null Het
Skp2 A G 15: 9,125,280 (GRCm39) S100P probably damaging Het
Smg5 T C 3: 88,256,540 (GRCm39) S269P probably benign Het
Sspo A T 6: 48,432,352 (GRCm39) T684S probably benign Het
Syt3 A G 7: 44,042,782 (GRCm39) K355E probably damaging Het
Tcp10a A T 17: 7,610,903 (GRCm39) K355N probably damaging Het
Tnrc18 A G 5: 142,750,800 (GRCm39) probably benign Het
Tsfm A G 10: 126,866,339 (GRCm39) L74P probably benign Het
Ttn G C 2: 76,564,609 (GRCm39) N28509K probably damaging Het
Ube2l6 G A 2: 84,629,252 (GRCm39) M1I probably null Het
Vmn2r80 T A 10: 79,005,330 (GRCm39) H322Q probably damaging Het
Zkscan8 A T 13: 21,706,441 (GRCm39) S212T probably benign Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 36,158,912 (GRCm39) missense probably benign 0.04
IGL01662:Mdc1 APN 17 36,163,397 (GRCm39) missense probably benign 0.00
IGL01931:Mdc1 APN 17 36,159,123 (GRCm39) missense probably benign 0.00
IGL02542:Mdc1 APN 17 36,164,048 (GRCm39) missense probably damaging 0.96
IGL02823:Mdc1 APN 17 36,163,815 (GRCm39) missense probably damaging 0.99
IGL03411:Mdc1 APN 17 36,164,018 (GRCm39) missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 36,157,083 (GRCm39) missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 36,155,361 (GRCm39) missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 36,159,925 (GRCm39) missense probably benign 0.00
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0131:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R0132:Mdc1 UTSW 17 36,163,473 (GRCm39) missense probably damaging 0.99
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1406:Mdc1 UTSW 17 36,164,424 (GRCm39) missense probably benign 0.10
R1597:Mdc1 UTSW 17 36,156,758 (GRCm39) missense probably damaging 1.00
R1721:Mdc1 UTSW 17 36,158,718 (GRCm39) missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1888:Mdc1 UTSW 17 36,165,117 (GRCm39) missense probably benign 0.03
R1912:Mdc1 UTSW 17 36,161,703 (GRCm39) missense probably benign 0.19
R1912:Mdc1 UTSW 17 36,155,430 (GRCm39) missense probably benign 0.00
R1977:Mdc1 UTSW 17 36,161,822 (GRCm39) missense probably benign 0.01
R2121:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2122:Mdc1 UTSW 17 36,158,835 (GRCm39) missense probably benign 0.03
R2357:Mdc1 UTSW 17 36,158,337 (GRCm39) missense probably benign 0.00
R2842:Mdc1 UTSW 17 36,159,686 (GRCm39) missense probably benign 0.01
R2851:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2852:Mdc1 UTSW 17 36,159,902 (GRCm39) missense probably benign 0.04
R2964:Mdc1 UTSW 17 36,164,529 (GRCm39) missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 36,158,785 (GRCm39) unclassified probably benign
R3752:Mdc1 UTSW 17 36,156,821 (GRCm39) missense probably damaging 1.00
R4234:Mdc1 UTSW 17 36,159,716 (GRCm39) missense probably benign 0.00
R4641:Mdc1 UTSW 17 36,168,361 (GRCm39) missense probably benign 0.09
R4706:Mdc1 UTSW 17 36,163,671 (GRCm39) missense probably damaging 0.99
R4809:Mdc1 UTSW 17 36,159,993 (GRCm39) critical splice donor site probably null
R4833:Mdc1 UTSW 17 36,161,286 (GRCm39) missense probably benign 0.20
R5032:Mdc1 UTSW 17 36,161,481 (GRCm39) missense probably benign 0.00
R5047:Mdc1 UTSW 17 36,158,736 (GRCm39) missense probably benign 0.00
R5086:Mdc1 UTSW 17 36,159,522 (GRCm39) missense probably benign 0.00
R5172:Mdc1 UTSW 17 36,163,982 (GRCm39) missense probably benign 0.00
R5254:Mdc1 UTSW 17 36,158,814 (GRCm39) missense probably benign 0.00
R5473:Mdc1 UTSW 17 36,158,952 (GRCm39) missense probably benign 0.01
R5550:Mdc1 UTSW 17 36,156,776 (GRCm39) missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 36,159,438 (GRCm39) missense probably benign 0.00
R5888:Mdc1 UTSW 17 36,158,712 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,168,464 (GRCm39) missense probably benign 0.01
R6020:Mdc1 UTSW 17 36,159,525 (GRCm39) missense probably benign 0.04
R6219:Mdc1 UTSW 17 36,161,566 (GRCm39) missense probably benign 0.10
R7053:Mdc1 UTSW 17 36,157,218 (GRCm39) missense probably benign 0.00
R7073:Mdc1 UTSW 17 36,164,960 (GRCm39) missense probably benign 0.18
R7077:Mdc1 UTSW 17 36,156,839 (GRCm39) missense probably damaging 0.97
R7424:Mdc1 UTSW 17 36,164,201 (GRCm39) missense probably benign 0.04
R7443:Mdc1 UTSW 17 36,161,712 (GRCm39) missense probably damaging 0.98
R7467:Mdc1 UTSW 17 36,155,448 (GRCm39) missense probably benign 0.29
R7549:Mdc1 UTSW 17 36,159,749 (GRCm39) missense probably null 0.04
R7655:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7656:Mdc1 UTSW 17 36,161,773 (GRCm39) missense probably benign 0.01
R7960:Mdc1 UTSW 17 36,161,570 (GRCm39) nonsense probably null
R8350:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8450:Mdc1 UTSW 17 36,159,191 (GRCm39) missense probably benign 0.00
R8688:Mdc1 UTSW 17 36,161,383 (GRCm39) missense probably benign 0.10
R8726:Mdc1 UTSW 17 36,158,475 (GRCm39) missense probably benign 0.04
R8919:Mdc1 UTSW 17 36,158,843 (GRCm39) missense probably benign 0.00
R8961:Mdc1 UTSW 17 36,159,407 (GRCm39) missense probably benign 0.10
R9324:Mdc1 UTSW 17 36,164,258 (GRCm39) missense probably benign 0.10
R9363:Mdc1 UTSW 17 36,162,019 (GRCm39) missense probably benign 0.00
R9385:Mdc1 UTSW 17 36,161,396 (GRCm39) missense probably benign 0.00
RF025:Mdc1 UTSW 17 36,165,299 (GRCm39) critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 36,161,829 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCAGCCTCAAGAGACTGCAATTCC -3'
(R):5'- TCATCAGGCGGCAAGAAGCAAC -3'

Sequencing Primer
(F):5'- CCATGCAGAAGAAGTGACCC -3'
(R):5'- actgagtcatcccagccc -3'
Posted On 2013-04-11