Incidental Mutation 'R1935:Mtcl1'
ID215960
Institutional Source Beutler Lab
Gene Symbol Mtcl1
Ensembl Gene ENSMUSG00000052105
Gene Namemicrotubule crosslinking factor 1
SynonymsSoga2, t8219b25, 1110012J17Rik
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1935 (G1)
Quality Score154
Status Validated
Chromosome17
Chromosomal Location66336982-66449750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66379414 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 480 (H480Q)
Ref Sequence ENSEMBL: ENSMUSP00000135690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086693] [ENSMUST00000097291] [ENSMUST00000145347] [ENSMUST00000177034]
Predicted Effect probably benign
Transcript: ENSMUST00000086693
AA Change: H832Q

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083899
Gene: ENSMUSG00000052105
AA Change: H832Q

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 493 587 1.8e-34 PFAM
Pfam:DUF3166 622 714 3.8e-39 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1344 3e-40 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
low complexity region 1912 1924 N/A INTRINSIC
low complexity region 1931 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097291
AA Change: H832Q

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094894
Gene: ENSMUSG00000052105
AA Change: H832Q

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 492 588 1.8e-43 PFAM
Pfam:DUF3166 621 716 5e-19 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1392 3.9e-49 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144492
Predicted Effect probably benign
Transcript: ENSMUST00000145347
AA Change: H383Q

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121387
Gene: ENSMUSG00000052105
AA Change: H383Q

DomainStartEndE-ValueType
Pfam:DUF3166 43 139 9.1e-44 PFAM
Pfam:DUF3166 172 267 2.5e-19 PFAM
low complexity region 394 410 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 600 613 N/A INTRINSIC
coiled coil region 671 710 N/A INTRINSIC
Pfam:DUF4482 771 910 4.6e-49 PFAM
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1223 1232 N/A INTRINSIC
low complexity region 1463 1475 N/A INTRINSIC
low complexity region 1482 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177034
AA Change: H480Q

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135690
Gene: ENSMUSG00000052105
AA Change: H480Q

DomainStartEndE-ValueType
Pfam:DUF3166 140 236 1.5e-43 PFAM
Pfam:DUF3166 269 364 4e-19 PFAM
low complexity region 491 507 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
coiled coil region 642 674 N/A INTRINSIC
low complexity region 738 751 N/A INTRINSIC
coiled coil region 809 848 N/A INTRINSIC
Pfam:DUF4482 909 1042 4e-49 PFAM
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1369 1378 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype PHENOTYPE: Global or Purkinje cell-specific homozygous knockout affects Purkinje cell axon and dendrite morphology, resulting in abnormal motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Mtcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Mtcl1 APN 17 66344319 missense probably benign 0.00
IGL01774:Mtcl1 APN 17 66385885 missense probably damaging 1.00
IGL01918:Mtcl1 APN 17 66368268 missense possibly damaging 0.47
IGL02000:Mtcl1 APN 17 66354190 missense probably benign 0.19
IGL02074:Mtcl1 APN 17 66366468 missense possibly damaging 0.68
IGL02338:Mtcl1 APN 17 66379970 missense probably damaging 1.00
IGL02597:Mtcl1 APN 17 66338021 missense probably benign
IGL03034:Mtcl1 APN 17 66344198 missense probably damaging 1.00
IGL03120:Mtcl1 APN 17 66379383 missense probably damaging 0.96
IGL03184:Mtcl1 APN 17 66354214 missense probably benign 0.01
IGL03240:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03294:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03332:Mtcl1 APN 17 66338019 missense probably damaging 1.00
PIT4378001:Mtcl1 UTSW 17 66438279 missense probably damaging 1.00
PIT4520001:Mtcl1 UTSW 17 66385912 missense possibly damaging 0.48
R0110:Mtcl1 UTSW 17 66358114 missense possibly damaging 0.51
R0113:Mtcl1 UTSW 17 66354242 missense possibly damaging 0.52
R0321:Mtcl1 UTSW 17 66379431 missense probably damaging 1.00
R0366:Mtcl1 UTSW 17 66338129 missense probably damaging 1.00
R0629:Mtcl1 UTSW 17 66338142 missense possibly damaging 0.89
R1466:Mtcl1 UTSW 17 66380435 missense probably damaging 1.00
R1467:Mtcl1 UTSW 17 66448327 missense probably damaging 1.00
R1471:Mtcl1 UTSW 17 66379148 missense probably damaging 0.96
R1650:Mtcl1 UTSW 17 66385876 missense probably damaging 1.00
R1754:Mtcl1 UTSW 17 66380183 missense probably damaging 1.00
R1855:Mtcl1 UTSW 17 66379514 missense probably benign
R1882:Mtcl1 UTSW 17 66379320 missense probably benign 0.01
R2063:Mtcl1 UTSW 17 66346355 missense probably damaging 1.00
R2132:Mtcl1 UTSW 17 66343623 missense probably benign 0.04
R2197:Mtcl1 UTSW 17 66366432 missense probably benign
R3196:Mtcl1 UTSW 17 66343834 missense probably benign 0.07
R3877:Mtcl1 UTSW 17 66342954 missense probably damaging 1.00
R4116:Mtcl1 UTSW 17 66366481 missense probably benign
R4204:Mtcl1 UTSW 17 66438261 missense probably damaging 1.00
R4373:Mtcl1 UTSW 17 66380079 missense probably benign 0.05
R4396:Mtcl1 UTSW 17 66344225 missense probably damaging 1.00
R4591:Mtcl1 UTSW 17 66348511 missense probably benign 0.07
R4610:Mtcl1 UTSW 17 66377887 missense probably benign 0.04
R4681:Mtcl1 UTSW 17 66449144 missense unknown
R4922:Mtcl1 UTSW 17 66348479 missense probably benign 0.29
R4992:Mtcl1 UTSW 17 66342839 missense probably damaging 0.99
R5169:Mtcl1 UTSW 17 66343823 missense probably benign 0.00
R5542:Mtcl1 UTSW 17 66384359 intron probably benign
R5804:Mtcl1 UTSW 17 66343137 missense probably benign 0.03
R5998:Mtcl1 UTSW 17 66368280 missense probably damaging 0.99
R6163:Mtcl1 UTSW 17 66379331 missense probably benign 0.10
R6191:Mtcl1 UTSW 17 66343526 missense probably damaging 1.00
R6254:Mtcl1 UTSW 17 66358134 missense probably benign 0.02
R6260:Mtcl1 UTSW 17 66343541 missense probably damaging 1.00
R6524:Mtcl1 UTSW 17 66348285 missense probably benign 0.15
R6884:Mtcl1 UTSW 17 66438202 missense probably damaging 1.00
R7199:Mtcl1 UTSW 17 66340539 missense probably benign 0.13
R7431:Mtcl1 UTSW 17 66342906 nonsense probably null
R7479:Mtcl1 UTSW 17 66379490 missense probably benign
R7564:Mtcl1 UTSW 17 66371327 missense probably benign
R7608:Mtcl1 UTSW 17 66343305 missense probably damaging 0.96
R7691:Mtcl1 UTSW 17 66380357 missense probably damaging 1.00
R7847:Mtcl1 UTSW 17 66344333 missense probably damaging 0.96
R7908:Mtcl1 UTSW 17 66371330 missense possibly damaging 0.80
R8262:Mtcl1 UTSW 17 66343658 missense probably damaging 0.99
R8324:Mtcl1 UTSW 17 66436217 missense probably damaging 1.00
R8477:Mtcl1 UTSW 17 66377947 missense probably benign 0.10
X0065:Mtcl1 UTSW 17 66379607 missense probably damaging 1.00
Z1088:Mtcl1 UTSW 17 66343728 missense probably benign 0.20
Z1176:Mtcl1 UTSW 17 66379460 missense probably benign 0.01
Z1177:Mtcl1 UTSW 17 66344295 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGGATGACTCTGTGAGG -3'
(R):5'- ACTCGGAGGACATGTTTGAG -3'

Sequencing Primer
(F):5'- ATGACTCTGTGAGGTGGGATAAG -3'
(R):5'- CATGTTTGAGAAGACCTCGGGC -3'
Posted On2014-07-14