Incidental Mutation 'R0129:Dhx57'
ID 21597
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 038414-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R0129 (G1)
Quality Score 133
Status Validated (trace)
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80546343 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1347 (K1347R)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably benign
Transcript: ENSMUST00000038166
AA Change: K1294R

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: K1294R

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: K1347R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: K1347R

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.1532 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,920,265 (GRCm39) D31G probably damaging Het
Actr2 A G 11: 20,050,939 (GRCm39) probably benign Het
Adcy8 A G 15: 64,618,862 (GRCm39) C764R probably benign Het
Ago4 A C 4: 126,410,976 (GRCm39) F171C possibly damaging Het
Akt2 T C 7: 27,336,395 (GRCm39) F408S probably damaging Het
Ankrd24 T C 10: 81,474,163 (GRCm39) L26P probably damaging Het
Appl1 A T 14: 26,650,600 (GRCm39) M524K probably damaging Het
Arhgef11 T A 3: 87,635,370 (GRCm39) I922N probably damaging Het
Atp5pd T C 11: 115,308,744 (GRCm39) E47G probably damaging Het
Birc6 A G 17: 74,835,755 (GRCm39) D70G probably benign Het
Bola2 G A 7: 126,295,731 (GRCm39) V56M probably damaging Het
Cd300lg A G 11: 101,944,918 (GRCm39) probably null Het
Cdc42bpb A G 12: 111,271,393 (GRCm39) probably benign Het
Ceacam20 A G 7: 19,710,185 (GRCm39) N403S probably damaging Het
Cenpf T C 1: 189,391,847 (GRCm39) M662V probably benign Het
Chd3 C A 11: 69,239,327 (GRCm39) E1607* probably null Het
Chtf18 A T 17: 25,946,285 (GRCm39) Y9* probably null Het
Clta A G 4: 44,032,424 (GRCm39) N200S probably benign Het
Csmd1 G A 8: 16,129,956 (GRCm39) S1722F possibly damaging Het
Cyria C T 12: 12,412,350 (GRCm39) T204I probably damaging Het
Dennd4a T C 9: 64,800,576 (GRCm39) S905P probably damaging Het
Dmc1 A T 15: 79,480,441 (GRCm39) probably benign Het
Dnhd1 G T 7: 105,370,131 (GRCm39) A4519S probably benign Het
Dnmbp A G 19: 43,838,466 (GRCm39) C1120R probably benign Het
Efs C T 14: 55,154,680 (GRCm39) A427T probably damaging Het
Erich6 T C 3: 58,531,799 (GRCm39) E399G probably damaging Het
Espl1 A G 15: 102,225,083 (GRCm39) T1431A probably benign Het
Fam184b A G 5: 45,690,120 (GRCm39) S830P probably damaging Het
Herc1 T A 9: 66,355,357 (GRCm39) C2203S probably damaging Het
Itpr1 G A 6: 108,326,637 (GRCm39) V120M probably damaging Het
Kcnh7 G A 2: 62,546,503 (GRCm39) T1026I probably benign Het
Kif1b A G 4: 149,345,658 (GRCm39) I394T probably benign Het
Ldlrap1 A C 4: 134,484,733 (GRCm39) V87G probably damaging Het
Lgals12 C T 19: 7,580,403 (GRCm39) V155I probably damaging Het
Limch1 A T 5: 67,116,933 (GRCm39) N116I probably damaging Het
Lonp2 C T 8: 87,361,518 (GRCm39) R232C probably damaging Het
Lrch1 C A 14: 75,073,186 (GRCm39) C151F probably benign Het
Lrig3 A G 10: 125,842,812 (GRCm39) Y579C probably damaging Het
Macf1 T C 4: 123,327,068 (GRCm39) S4808G probably damaging Het
Mapkap1 A T 2: 34,513,494 (GRCm39) K501N probably damaging Het
Mdc1 G T 17: 36,165,337 (GRCm39) R1523L probably benign Het
Mlh3 C T 12: 85,312,914 (GRCm39) probably benign Het
Mul1 T C 4: 138,165,032 (GRCm39) probably benign Het
Mybl2 G A 2: 162,901,411 (GRCm39) probably benign Het
Notch1 G C 2: 26,350,470 (GRCm39) H2223Q probably benign Het
Notch2 C A 3: 98,053,936 (GRCm39) L2200M probably benign Het
Odad3 G T 9: 21,904,848 (GRCm39) R313S probably damaging Het
Or10ak8 A T 4: 118,774,667 (GRCm39) probably null Het
Or12k5 G A 2: 36,895,057 (GRCm39) R190* probably null Het
Or5ae2 T A 7: 84,506,196 (GRCm39) F206L probably benign Het
Or8a1b T C 9: 37,623,236 (GRCm39) Y113C probably damaging Het
Plekhs1 T C 19: 56,465,722 (GRCm39) probably null Het
Ppm1h G A 10: 122,777,260 (GRCm39) G509R probably damaging Het
Ppp2r3c C T 12: 55,345,207 (GRCm39) E94K probably damaging Het
Ppp2r5e T A 12: 75,509,164 (GRCm39) I372F probably damaging Het
Ptprt G A 2: 162,119,990 (GRCm39) T159I probably benign Het
Rab20 A G 8: 11,504,415 (GRCm39) F95S probably damaging Het
Rfc3 A C 5: 151,574,616 (GRCm39) M1R probably null Het
Skp2 A G 15: 9,125,280 (GRCm39) S100P probably damaging Het
Smg5 T C 3: 88,256,540 (GRCm39) S269P probably benign Het
Sspo A T 6: 48,432,352 (GRCm39) T684S probably benign Het
Syt3 A G 7: 44,042,782 (GRCm39) K355E probably damaging Het
Tcp10a A T 17: 7,610,903 (GRCm39) K355N probably damaging Het
Tnrc18 A G 5: 142,750,800 (GRCm39) probably benign Het
Tsfm A G 10: 126,866,339 (GRCm39) L74P probably benign Het
Ttn G C 2: 76,564,609 (GRCm39) N28509K probably damaging Het
Ube2l6 G A 2: 84,629,252 (GRCm39) M1I probably null Het
Vmn2r80 T A 10: 79,005,330 (GRCm39) H322Q probably damaging Het
Zkscan8 A T 13: 21,706,441 (GRCm39) S212T probably benign Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCCCCACGTTTTCAGAAACACC -3'
(R):5'- GCCTGAATCCAGATTTTCAAGCACAC -3'

Sequencing Primer
(F):5'- CGTTTTCAGAAACACCAGTGTGG -3'
(R):5'- gaaacacatgctgtaacccc -3'
Posted On 2013-04-11