Mutagenetix > Incidental Mutations

Incidental Mutation 'R0576:Disp3'

215972

Institutional Source

Beutler Lab

Gene Symbol

Disp3

Ensembl Gene

ENSMUSG00000041544

Gene Name

dispatched RND transporter family member 3

Synonyms

Ptchd2, G630052C06Rik

MMRRC Submission

038766-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0576 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

148240264-148287965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 148241590 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1237 (T1237I)

Ref Sequence

ENSEMBL: ENSMUSP00000038490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047720]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047720
AA Change: T1237I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: T1237I

Domain	Start	End	E-Value	Type
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	159	171	N/A	INTRINSIC
low complexity region	179	195	N/A	INTRINSIC
Pfam:Patched	362	735	2.2e-21	PFAM
Pfam:MMPL	366	590	3.1e-14	PFAM
Pfam:Sterol-sensing	435	588	1.1e-17	PFAM
Pfam:Patched	1121	1301	1.6e-7	PFAM
transmembrane domain	1314	1333	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 94.9%

Validation Efficiency

92% (47/51)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	T	2: 130,713,470	F839L	probably benign	Het
Ccdc77	T	A	6: 120,331,848	L335F	probably benign	Het
Ccr3	T	A	9: 124,029,009	F127Y	probably damaging	Het
Cfap43	T	C	19: 47,797,140	N437S	probably benign	Het
Cfh	A	G	1: 140,136,815	V365A	probably damaging	Het
Copg1	T	A	6: 87,897,963	V380D	probably damaging	Het
Cxxc1	T	C	18: 74,220,185	I497T	possibly damaging	Het
Dnah7a	A	T	1: 53,636,087	F360L	probably benign	Het
Dnhd1	C	T	7: 105,714,045	A3938V	probably damaging	Het
Eif4g1	A	G	16: 20,684,068	D1000G	probably damaging	Het
Emsy	A	T	7: 98,593,776	V1052D	probably damaging	Het
Ep400	A	G	5: 110,711,093		probably benign	Het
Fa2h	T	C	8: 111,356,147	H146R	probably damaging	Het
Gad1	G	A	2: 70,594,652	C430Y	probably benign	Het
Gm38394	A	G	1: 133,657,838	F587S	probably benign	Het
Gtse1	T	C	15: 85,869,051	S456P	probably damaging	Het
Gucy2g	T	C	19: 55,198,770	T1073A	probably damaging	Het
Hectd2	T	G	19: 36,585,497	N3K	probably benign	Het
Hmcn1	A	T	1: 150,650,017	C3318*	probably null	Het
Lipo2	C	T	19: 33,749,424	S71N	probably benign	Het
Mynn	G	T	3: 30,607,068	D100Y	probably damaging	Het
Myo16	G	A	8: 10,562,318		probably null	Het
Npr2	G	T	4: 43,640,947	K384N	probably benign	Het
Nrde2	A	G	12: 100,132,233	V725A	possibly damaging	Het
Olfr166	A	G	16: 19,487,188	M117V	probably damaging	Het
Olfr748	T	A	14: 50,711,204	S291R	probably damaging	Het
Otud7a	C	T	7: 63,685,518	P101S	possibly damaging	Het
Pcdhb7	T	A	18: 37,342,357	L182Q	probably benign	Het
Pdss1	A	G	2: 22,915,413		probably null	Het
Ppargc1b	T	A	18: 61,311,441	H233L	probably damaging	Het
Ppm1b	A	G	17: 85,013,559		probably null	Het
Prdm14	A	T	1: 13,125,725	S37R	possibly damaging	Het
Prss45	A	G	9: 110,838,429	T39A	probably benign	Het
Qars	T	C	9: 108,514,962		probably benign	Het
Rxfp2	T	G	5: 150,038,247	H77Q	probably benign	Het
Scd4	A	G	19: 44,341,246	M219V	probably benign	Het
Sec24b	G	T	3: 130,041,336	P71Q	probably benign	Het
Snd1	T	G	6: 28,886,577	V861G	probably benign	Het
Sspo	A	G	6: 48,464,942		probably null	Het
Tas2r129	A	G	6: 132,951,534	T145A	probably benign	Het
Tbc1d31	T	A	15: 57,969,724	I953N	possibly damaging	Het
Tlr4	A	G	4: 66,839,495	N175S	probably benign	Het
Tspyl4	A	G	10: 34,298,522	N337D	probably damaging	Het
Ttn	A	T	2: 76,812,201	L13330H	probably damaging	Het
Usp33	T	A	3: 152,384,119	Y765*	probably null	Het
Vmn2r59	T	A	7: 42,047,105	Y71F	probably benign	Het
Zfhx4	T	C	3: 5,402,101	S2465P	probably damaging	Het

Other mutations in Disp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Disp3	APN	4	148241534	missense	probably benign	0.10
IGL01065:Disp3	APN	4	148261183	missense	probably damaging	1.00
IGL01800:Disp3	APN	4	148249801	nonsense	probably null
IGL01947:Disp3	APN	4	148260519	missense	probably damaging	1.00
IGL02510:Disp3	APN	4	148252701	missense	probably benign	0.00
IGL02573:Disp3	APN	4	148271449	missense	probably damaging	1.00
IGL02728:Disp3	APN	4	148272038	missense	probably damaging	1.00
IGL02931:Disp3	APN	4	148249201	missense	possibly damaging	0.94
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0257:Disp3	UTSW	4	148250754	missense	possibly damaging	0.87
R0409:Disp3	UTSW	4	148271959	missense	probably damaging	1.00
R0557:Disp3	UTSW	4	148241404	missense	possibly damaging	0.64
R1495:Disp3	UTSW	4	148249825	missense	probably benign	0.00
R1526:Disp3	UTSW	4	148259916	missense	probably benign	0.00
R1791:Disp3	UTSW	4	148241518	missense	probably damaging	1.00
R1856:Disp3	UTSW	4	148271632	missense	probably damaging	1.00
R1987:Disp3	UTSW	4	148258753	missense	probably damaging	0.97
R2030:Disp3	UTSW	4	148259966	missense	probably damaging	1.00
R2271:Disp3	UTSW	4	148271602	missense	possibly damaging	0.87
R2373:Disp3	UTSW	4	148258795	missense	probably damaging	1.00
R2566:Disp3	UTSW	4	148241423	missense	probably damaging	1.00
R3731:Disp3	UTSW	4	148252827	missense	probably benign	0.03
R4359:Disp3	UTSW	4	148271932	missense	probably benign	0.03
R4762:Disp3	UTSW	4	148272118	missense	probably damaging	1.00
R4950:Disp3	UTSW	4	148258126	missense	possibly damaging	0.94
R4975:Disp3	UTSW	4	148244216	missense	possibly damaging	0.79
R5218:Disp3	UTSW	4	148242876	missense	possibly damaging	0.88
R5523:Disp3	UTSW	4	148258097	missense	probably benign	0.14
R5556:Disp3	UTSW	4	148258157	missense	probably benign	0.14
R5857:Disp3	UTSW	4	148249183	missense	probably benign	0.01
R5933:Disp3	UTSW	4	148241313	nonsense	probably null
R5994:Disp3	UTSW	4	148254284	missense	possibly damaging	0.94
R6362:Disp3	UTSW	4	148254308	missense	possibly damaging	0.95
R6813:Disp3	UTSW	4	148259930	missense	probably benign	0.09
R7211:Disp3	UTSW	4	148241522	missense	probably damaging	0.98
R7470:Disp3	UTSW	4	148261070	missense	possibly damaging	0.88
R7535:Disp3	UTSW	4	148242866	missense	probably damaging	0.99
R8093:Disp3	UTSW	4	148270516	missense	possibly damaging	0.93
R8357:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8457:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8506:Disp3	UTSW	4	148241570	missense	possibly damaging	0.77
Z1088:Disp3	UTSW	4	148271743	missense	possibly damaging	0.63
Z1176:Disp3	UTSW	4	148250957	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249746	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249847	missense	probably benign	0.01
Z1177:Disp3	UTSW	4	148250714	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148270567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCAAGGCAAGTTGCGTGAGTC -3'
(R):5'- TCCTACAGCCTATCAGCATGGGATG -3'

Sequencing Primer
(F):5'- CCTTAAGAAAGGAAGTCCTGGTCC -3'
(R):5'- ctctctctctctctctctctctg -3'

Posted On

2014-07-16