Mutagenetix > Incidental Mutation

Incidental Mutation 'R0590:Kif14'

215974

Institutional Source

Beutler Lab

Gene Symbol

Kif14

Ensembl Gene

ENSMUSG00000041498

Gene Name

kinesin family member 14

Synonyms

N-3 kinesin, D1Ertd367e

MMRRC Submission

038780-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R0590 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

136466343-136531511 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136482472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 646 (S646P)

Ref Sequence

ENSEMBL: ENSMUSP00000139698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000195274] [ENSMUST00000201676]

AlphaFold

L0N7N1

PDB Structure

Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047817
AA Change: S596P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: S596P

Domain	Start	End	E-Value	Type
KISc	341	694	1.45e-180	SMART
FHA	809	861	1.46e-7	SMART
coiled coil region	911	1060	N/A	INTRINSIC
low complexity region	1169	1179	N/A	INTRINSIC
low complexity region	1548	1559	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187963

Predicted Effect

probably damaging
Transcript: ENSMUST00000189413
AA Change: S646P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: S646P

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	744	1.45e-180	SMART
FHA	859	911	1.46e-7	SMART
coiled coil region	961	1110	N/A	INTRINSIC
low complexity region	1219	1229	N/A	INTRINSIC
low complexity region	1598	1609	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193587

Predicted Effect

probably benign
Transcript: ENSMUST00000195274

SMART Domains

Protein: ENSMUSP00000142040
Gene: ENSMUSG00000041498

Domain	Start	End	E-Value	Type
Pfam:Kinesin	29	69	3.7e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195390

Predicted Effect

probably benign
Transcript: ENSMUST00000201676

SMART Domains

Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

Domain	Start	End	E-Value	Type
low complexity region	278	290	N/A	INTRINSIC
KISc	391	497	3.7e-6	SMART

Meta Mutation Damage Score

0.4680

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat2	C	T	4: 49,383,273	M93I	probably benign	Het
Adamts16	T	C	13: 70,800,954	D196G	probably benign	Het
Adhfe1	T	A	1: 9,548,153		probably null	Het
AI661453	A	G	17: 47,467,074		probably benign	Het
Apc	G	T	18: 34,316,230	E2026*	probably null	Het
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
BC017158	A	G	7: 128,297,470	L134P	probably damaging	Het
Cad	T	C	5: 31,062,231	S688P	probably damaging	Het
Ccdc191	C	T	16: 43,931,341	R345*	probably null	Het
Dcaf13	T	A	15: 39,145,085		probably benign	Het
Drc1	A	G	5: 30,363,136	D607G	probably benign	Het
Fam160a1	T	C	3: 85,672,376	R841G	probably benign	Het
Gli1	G	T	10: 127,331,563	A607E	possibly damaging	Het
Gls	G	A	1: 52,212,375		probably benign	Het
Gria1	A	T	11: 57,289,409	Q728H	probably damaging	Het
Hcrtr1	A	G	4: 130,135,694	L198P	probably damaging	Het
Ifngr1	T	A	10: 19,603,942		probably benign	Het
Ipo5	T	C	14: 120,944,357	V954A	possibly damaging	Het
Kcnh5	G	T	12: 74,965,261	A628D	probably damaging	Het
Ksr1	A	G	11: 79,045,140	S133P	probably damaging	Het
Neb	T	C	2: 52,137,290	M7143V	probably damaging	Het
Nelfa	G	A	5: 33,901,825	P229S	probably damaging	Het
Nfatc2	T	C	2: 168,571,199	T169A	probably damaging	Het
Nr1h4	A	G	10: 89,456,567	Y398H	probably damaging	Het
Nrcam	A	G	12: 44,564,032	E511G	probably damaging	Het
Ocstamp	T	A	2: 165,397,751	R172W	probably damaging	Het
Olfr1130	A	G	2: 87,607,994	E202G	probably damaging	Het
Olfr26	T	A	9: 38,855,470	M136K	probably damaging	Het
Olfr27	T	C	9: 39,144,721	V207A	probably benign	Het
Phf14	G	A	6: 11,961,578	V405I	possibly damaging	Het
Plk5	G	A	10: 80,360,223	R238H	probably damaging	Het
Pole	A	G	5: 110,317,926	E1240G	probably benign	Het
Prdm15	A	G	16: 97,797,761	I899T	possibly damaging	Het
Psip1	T	C	4: 83,458,144	N486S	probably benign	Het
Rlf	A	G	4: 121,170,833		probably benign	Het
Rttn	T	C	18: 88,979,635	S255P	probably damaging	Het
Sema6c	A	G	3: 95,172,623	K711E	probably damaging	Het
Slc4a10	A	T	2: 62,190,893		probably benign	Het
Trim36	T	G	18: 46,172,576	S435R	probably benign	Het
Ucp1	A	G	8: 83,291,603		probably benign	Het
Vmn1r17	T	C	6: 57,361,014	Y122C	probably benign	Het
Vmn1r23	A	G	6: 57,926,364	V143A	probably benign	Het
Wdfy4	T	A	14: 33,041,174	Q2166L	probably benign	Het
Zc3h7b	C	T	15: 81,776,998	T346M	possibly damaging	Het
Zfhx4	T	A	3: 5,402,633	V2617D	probably damaging	Het

Other mutations in Kif14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00159:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00160:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00164:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00310:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00330:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00335:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00434:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL00468:Kif14	APN	1	136469018	missense	probably benign	0.11
IGL01330:Kif14	APN	1	136476374	missense	probably damaging	0.99
IGL01530:Kif14	APN	1	136478419	splice site	probably benign
IGL01622:Kif14	APN	1	136497356	splice site	probably benign
IGL01689:Kif14	APN	1	136519642	missense	probably damaging	0.99
IGL02115:Kif14	APN	1	136496567	splice site	probably benign
IGL02252:Kif14	APN	1	136478392	missense	probably damaging	1.00
IGL02259:Kif14	APN	1	136500102	missense	probably benign
IGL02439:Kif14	APN	1	136490261	missense	probably damaging	1.00
IGL02590:Kif14	APN	1	136496004	missense	probably benign	0.00
IGL02606:Kif14	APN	1	136496593	missense	probably damaging	1.00
IGL03253:Kif14	APN	1	136487460	missense	probably damaging	0.97
R0106:Kif14	UTSW	1	136479924	splice site	probably benign
R0193:Kif14	UTSW	1	136468438	missense	probably benign	0.00
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0238:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0239:Kif14	UTSW	1	136527393	missense	probably damaging	0.99
R0329:Kif14	UTSW	1	136496026	splice site	probably benign
R0346:Kif14	UTSW	1	136468160	missense	probably damaging	1.00
R0393:Kif14	UTSW	1	136482418	missense	probably damaging	1.00
R0519:Kif14	UTSW	1	136469147	missense	probably damaging	1.00
R0633:Kif14	UTSW	1	136527305	missense	probably damaging	0.96
R0657:Kif14	UTSW	1	136469102	missense	probably benign	0.07
R0831:Kif14	UTSW	1	136525871	splice site	probably benign
R0971:Kif14	UTSW	1	136519654	missense	probably damaging	0.98
R1018:Kif14	UTSW	1	136495841	splice site	probably benign
R1520:Kif14	UTSW	1	136503324	missense	probably benign	0.00
R1713:Kif14	UTSW	1	136527464	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136468279	missense	probably benign
R1728:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1728:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1728:Kif14	UTSW	1	136490332	missense	probably benign
R1728:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1728:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1728:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1729:Kif14	UTSW	1	136468279	missense	probably benign
R1729:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1729:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1729:Kif14	UTSW	1	136490332	missense	probably benign
R1729:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1729:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1729:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1730:Kif14	UTSW	1	136468279	missense	probably benign
R1730:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1730:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1730:Kif14	UTSW	1	136490332	missense	probably benign
R1730:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1730:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1730:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1739:Kif14	UTSW	1	136468279	missense	probably benign
R1739:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1739:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1739:Kif14	UTSW	1	136490332	missense	probably benign
R1739:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1739:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1739:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1762:Kif14	UTSW	1	136468279	missense	probably benign
R1762:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1762:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1762:Kif14	UTSW	1	136490332	missense	probably benign
R1762:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1762:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1762:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1783:Kif14	UTSW	1	136468279	missense	probably benign
R1783:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1783:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1783:Kif14	UTSW	1	136490332	missense	probably benign
R1783:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1783:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1783:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1784:Kif14	UTSW	1	136468279	missense	probably benign
R1784:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1784:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1784:Kif14	UTSW	1	136490332	missense	probably benign
R1784:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1784:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1784:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1785:Kif14	UTSW	1	136468279	missense	probably benign
R1785:Kif14	UTSW	1	136468975	missense	probably damaging	1.00
R1785:Kif14	UTSW	1	136478365	missense	probably benign	0.00
R1785:Kif14	UTSW	1	136490332	missense	probably benign
R1785:Kif14	UTSW	1	136503431	missense	probably benign	0.10
R1785:Kif14	UTSW	1	136515961	missense	probably benign	0.04
R1785:Kif14	UTSW	1	136525783	missense	probably benign	0.03
R1872:Kif14	UTSW	1	136486358	missense	probably damaging	1.00
R2049:Kif14	UTSW	1	136487080	missense	probably benign
R2049:Kif14	UTSW	1	136510167	missense	possibly damaging	0.68
R2268:Kif14	UTSW	1	136519748	nonsense	probably null
R2373:Kif14	UTSW	1	136479845	missense	probably damaging	1.00
R3076:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3077:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R3078:Kif14	UTSW	1	136519645	missense	possibly damaging	0.51
R4232:Kif14	UTSW	1	136516363	nonsense	probably null
R4246:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4247:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4250:Kif14	UTSW	1	136473388	missense	possibly damaging	0.80
R4672:Kif14	UTSW	1	136521278	missense	probably benign	0.00
R4672:Kif14	UTSW	1	136521279	missense	probably benign
R4890:Kif14	UTSW	1	136487130	missense	possibly damaging	0.91
R4994:Kif14	UTSW	1	136482959	missense	probably damaging	1.00
R5102:Kif14	UTSW	1	136516403	missense	probably benign	0.00
R5185:Kif14	UTSW	1	136527469	nonsense	probably null
R5201:Kif14	UTSW	1	136503407	missense	probably benign	0.00
R5399:Kif14	UTSW	1	136503324	missense	probably benign	0.00
R5431:Kif14	UTSW	1	136496695	missense	possibly damaging	0.91
R5932:Kif14	UTSW	1	136516390	missense	probably benign	0.23
R6027:Kif14	UTSW	1	136483059	splice site	probably null
R6246:Kif14	UTSW	1	136476424	nonsense	probably null
R6331:Kif14	UTSW	1	136515986	missense	probably null	1.00
R6448:Kif14	UTSW	1	136503347	missense	probably damaging	0.99
R6453:Kif14	UTSW	1	136482304	splice site	probably null
R6475:Kif14	UTSW	1	136527411	missense	probably damaging	1.00
R6631:Kif14	UTSW	1	136515959	missense	probably benign	0.39
R6713:Kif14	UTSW	1	136525806	missense	probably benign
R7173:Kif14	UTSW	1	136479170	missense	probably damaging	0.98
R7174:Kif14	UTSW	1	136521257	missense	possibly damaging	0.67
R7241:Kif14	UTSW	1	136468753	missense	probably benign	0.41
R7674:Kif14	UTSW	1	136468820	missense	probably damaging	0.99
R7688:Kif14	UTSW	1	136494654	missense	probably damaging	1.00
R7711:Kif14	UTSW	1	136471453	missense	probably benign	0.10
R7722:Kif14	UTSW	1	136468295	missense	probably benign	0.00
R7763:Kif14	UTSW	1	136516383	missense	probably benign	0.00
R7882:Kif14	UTSW	1	136471576	critical splice donor site	probably null
R7882:Kif14	UTSW	1	136516025	missense	probably benign	0.43
R8077:Kif14	UTSW	1	136471448	missense	possibly damaging	0.87
R8101:Kif14	UTSW	1	136476352	missense	probably benign	0.14
R8308:Kif14	UTSW	1	136515913	missense	possibly damaging	0.90
R8338:Kif14	UTSW	1	136494678	missense	probably damaging	1.00
R8527:Kif14	UTSW	1	136468757	missense	possibly damaging	0.95
R8542:Kif14	UTSW	1	136468757	missense	possibly damaging	0.95
R8884:Kif14	UTSW	1	136486351	missense
R9435:Kif14	UTSW	1	136473436	missense	possibly damaging	0.92
R9499:Kif14	UTSW	1	136527481	missense	probably damaging	0.96
R9551:Kif14	UTSW	1	136527481	missense	probably damaging	0.96
R9577:Kif14	UTSW	1	136471400	missense	probably benign	0.00
X0021:Kif14	UTSW	1	136490276	missense	probably damaging	1.00
Z1176:Kif14	UTSW	1	136496653	missense	probably damaging	0.97
Z1176:Kif14	UTSW	1	136500016	critical splice acceptor site	probably null
Z1177:Kif14	UTSW	1	136478365	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCACAATCGAAGTGCTGTTCAGTATGT -3'
(R):5'- TCAGAGTGAGTTTCAGCATCAGGAGAA -3'

Sequencing Primer
(F):5'- aattcaattcccagcaaccac -3'
(R):5'- TTTCAGCATCAGGAGAAGAGTG -3'

Posted On

2014-07-16