Incidental Mutation 'R0590:Ocstamp'
ID215975
Institutional Source Beutler Lab
Gene Symbol Ocstamp
Ensembl Gene ENSMUSG00000027670
Gene Nameosteoclast stimulatory transmembrane protein
Synonyms
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0590 (G1)
Quality Score60
Status Validated
Chromosome2
Chromosomal Location165393760-165400405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165397751 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 172 (R172W)
Ref Sequence ENSEMBL: ENSMUSP00000029213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029213]
Predicted Effect probably damaging
Transcript: ENSMUST00000029213
AA Change: R172W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029213
Gene: ENSMUSG00000027670
AA Change: R172W

DomainStartEndE-ValueType
transmembrane domain 52 71 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
transmembrane domain 121 140 N/A INTRINSIC
transmembrane domain 222 244 N/A INTRINSIC
Pfam:DC_STAMP 253 445 1.5e-35 PFAM
Meta Mutation Damage Score 0.2264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is orthologous to the mouse osteoclast stimulatory transmembrane protein (OCSTAMP), which is a membrane-anchored cell surface receptor that promotes nucleation of osteoclasts. The mouse protein is also involved in bone resorption and osteoclast differentiation. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective osteoclast fusion but normal skeletal paramaters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Ksr1 A G 11: 79,045,140 S133P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Ocstamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02109:Ocstamp APN 2 165397336 missense possibly damaging 0.65
IGL02207:Ocstamp APN 2 165397663 missense possibly damaging 0.66
IGL02863:Ocstamp APN 2 165397508 missense probably damaging 1.00
R0309:Ocstamp UTSW 2 165395992 missense possibly damaging 0.75
R0402:Ocstamp UTSW 2 165396264 missense possibly damaging 0.55
R0624:Ocstamp UTSW 2 165397852 missense probably damaging 0.97
R1385:Ocstamp UTSW 2 165396039 missense probably benign 0.00
R1657:Ocstamp UTSW 2 165397516 missense probably damaging 0.99
R1696:Ocstamp UTSW 2 165396174 missense probably damaging 1.00
R4371:Ocstamp UTSW 2 165397313 missense possibly damaging 0.66
R4746:Ocstamp UTSW 2 165396288 missense probably benign 0.40
R4815:Ocstamp UTSW 2 165398182 missense probably benign 0.01
R5979:Ocstamp UTSW 2 165397547 missense probably damaging 1.00
R6821:Ocstamp UTSW 2 165397922 missense probably benign 0.00
R7084:Ocstamp UTSW 2 165398037 nonsense probably null
R7171:Ocstamp UTSW 2 165398161 missense probably benign
R7313:Ocstamp UTSW 2 165397309 missense probably damaging 1.00
Z1088:Ocstamp UTSW 2 165395918 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTGTCGAAACGCAGGTCAGTGAGG -3'
(R):5'- TTTGTGCTCAGTGTGCCAACCC -3'

Sequencing Primer
(F):5'- GCAGGAACAACCCGGTG -3'
(R):5'- CAACCCTGGGCTCCAAG -3'
Posted On2014-07-16