Incidental Mutation 'R0081:Olfr344'
List |< first << previous [record 46 of 75] next >> last >|
ID215980
Institutional Source Beutler Lab
Gene Symbol Olfr344
Ensembl Gene ENSMUSG00000096822
Gene Nameolfactory receptor 344
SynonymsGA_x6K02T2NLDC-33262744-33263673, MOR136-12
MMRRC Submission 038368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0081 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36566662-36576178 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 36568881 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 94 (Y94*)
Ref Sequence ENSEMBL: ENSMUSP00000151202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075474] [ENSMUST00000215879]
Predicted Effect probably null
Transcript: ENSMUST00000075474
AA Change: Y94*
SMART Domains Protein: ENSMUSP00000074919
Gene: ENSMUSG00000096822
AA Change: Y94*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215879
AA Change: Y94*
Meta Mutation Damage Score 0.9572 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.2%
  • 10x: 88.5%
  • 20x: 63.6%
Validation Efficiency 94% (159/169)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T C 8: 24,781,687 D485G probably damaging Het
Adamts19 T C 18: 58,903,065 probably null Het
Adgrd1 A T 5: 129,178,082 I598F probably damaging Het
Adh5 A G 3: 138,451,413 D245G probably benign Het
Adra2b T C 2: 127,364,292 V238A probably benign Het
Ank1 G A 8: 23,116,242 V1188I possibly damaging Het
Asap1 C T 15: 64,099,564 G905D probably damaging Het
AW554918 T C 18: 25,344,902 V428A probably benign Het
Birc6 T A 17: 74,643,441 S3226T probably benign Het
Cdh17 A T 4: 11,785,280 probably benign Het
Cyfip2 A T 11: 46,253,998 Y676* probably null Het
Dcaf17 T A 2: 71,078,468 probably benign Het
Dclre1a A G 19: 56,542,707 F736L probably damaging Het
Ddx41 A T 13: 55,535,380 H171Q possibly damaging Het
Dennd5b G T 6: 148,993,759 Q1258K probably benign Het
Dock10 T C 1: 80,606,578 D137G probably damaging Het
Dpyd G A 3: 118,944,255 V482I probably benign Het
Erich6 A T 3: 58,636,126 probably benign Het
Fam193b A G 13: 55,554,211 probably benign Het
Foxp2 T C 6: 15,405,644 probably benign Het
Frmd4a T C 2: 4,572,441 probably null Het
Gas2l2 A G 11: 83,422,867 S540P possibly damaging Het
Glis2 T C 16: 4,613,653 V348A probably benign Het
Gm14443 C A 2: 175,169,936 G239V probably damaging Het
Gpr158 T C 2: 21,826,717 V876A probably damaging Het
H1foo A G 6: 115,949,981 E273G probably benign Het
Hadh C T 3: 131,235,636 D245N probably damaging Het
Hk2 A T 6: 82,734,976 probably benign Het
Ice1 A T 13: 70,619,044 Y108* probably null Het
Il10ra T G 9: 45,255,949 M435L probably benign Het
Inpp5k GT G 11: 75,631,147 probably null Het
Kank4 G T 4: 98,778,330 P627T probably benign Het
Kif16b A G 2: 142,707,426 probably benign Het
Lipn A G 19: 34,076,976 I205V probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myh1 T C 11: 67,215,857 M1255T probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo1d T G 11: 80,557,523 K925N probably benign Het
Myoz1 T A 14: 20,649,554 M239L probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nf1 C A 11: 79,453,979 probably benign Het
Npepl1 C T 2: 174,116,086 P239S probably damaging Het
Olfml1 A G 7: 107,571,299 K131R probably benign Het
Olfr1258 T A 2: 89,930,079 I90K possibly damaging Het
Olfr1303 A C 2: 111,813,868 I286S probably damaging Het
Olfr352 T C 2: 36,870,010 L148S possibly damaging Het
Olfr358 G A 2: 37,005,450 L55F probably damaging Het
Olfr389 A G 11: 73,777,109 F73L possibly damaging Het
Olfr472 C T 7: 107,903,005 T96I probably benign Het
Olfr771 C T 10: 129,160,838 D49N possibly damaging Het
Pde7a T C 3: 19,241,533 probably benign Het
Pik3c2g T C 6: 139,957,793 C591R probably benign Het
Pkn2 T G 3: 142,853,582 K61Q probably damaging Het
Ppfia1 C A 7: 144,504,974 G722C probably damaging Het
Ppp1cb T C 5: 32,487,614 V263A probably damaging Het
Rab11fip2 A T 19: 59,907,135 N440K possibly damaging Het
Rbm34 T A 8: 126,949,484 K340N probably damaging Het
Samd3 T C 10: 26,271,501 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sigirr T C 7: 141,091,372 D399G probably damaging Het
Slc17a7 A G 7: 45,174,947 E554G probably benign Het
Smc3 A G 19: 53,601,562 probably benign Het
Tdrd1 T C 19: 56,831,271 Y68H probably benign Het
Tespa1 T A 10: 130,360,850 L219Q probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Ttc38 A G 15: 85,856,472 S436G probably benign Het
Ttn T A 2: 76,751,079 I23157F probably damaging Het
Ubxn2b T A 4: 6,203,875 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r72 T C 7: 85,751,836 E125G probably benign Het
Vmn2r78 A T 7: 86,923,027 D532V probably benign Het
Vwa8 C A 14: 79,082,782 L1078I probably benign Het
Vwce A T 19: 10,664,089 probably null Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Olfr344
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr344 APN 2 36568826 missense probably damaging 1.00
IGL01450:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01452:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01458:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01466:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01470:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01476:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01477:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01478:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01480:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01481:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01487:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01522:Olfr344 APN 2 36569221 missense probably benign 0.00
IGL02141:Olfr344 APN 2 36568808 missense probably damaging 1.00
IGL02510:Olfr344 APN 2 36568681 missense possibly damaging 0.87
IGL02896:Olfr344 APN 2 36569205 missense possibly damaging 0.88
IGL03032:Olfr344 APN 2 36568704 nonsense probably null
R0581:Olfr344 UTSW 2 36568822 missense probably damaging 1.00
R0611:Olfr344 UTSW 2 36569556 unclassified probably null
R1503:Olfr344 UTSW 2 36568873 missense probably damaging 1.00
R1844:Olfr344 UTSW 2 36568777 missense probably damaging 1.00
R2320:Olfr344 UTSW 2 36568625 missense possibly damaging 0.90
R4088:Olfr344 UTSW 2 36569018 missense probably damaging 1.00
R5243:Olfr344 UTSW 2 36568643 missense probably damaging 1.00
R5747:Olfr344 UTSW 2 36568967 missense probably damaging 0.98
R5948:Olfr344 UTSW 2 36569351 missense probably damaging 1.00
R6115:Olfr344 UTSW 2 36568951 missense probably damaging 1.00
R6158:Olfr344 UTSW 2 36569116 missense probably benign 0.03
R6198:Olfr344 UTSW 2 36568951 missense probably damaging 1.00
R6531:Olfr344 UTSW 2 36569341 missense probably damaging 1.00
R7075:Olfr344 UTSW 2 36569180 missense probably benign 0.01
R7193:Olfr344 UTSW 2 36569236 missense probably benign 0.06
R7329:Olfr344 UTSW 2 36568696 missense probably benign
R7659:Olfr344 UTSW 2 36568625 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATCATCCTGCTCATCAGGCTGGAC -3'
(R):5'- TGAGCTGGACAGCTTCAGCAAAG -3'

Sequencing Primer
(F):5'- ATCAGGCTGGACCCTCAC -3'
(R):5'- TTGCACAAGGGCATTGGC -3'
Posted On2014-07-16