Incidental Mutation 'R0129:Lgals12'
ID21599
Institutional Source Beutler Lab
Gene Symbol Lgals12
Ensembl Gene ENSMUSG00000024972
Gene Namelectin, galactose binding, soluble 12
SynonymsGRIP1, galectin-12, galectin-related inhibitor of proliferation
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0129 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location7596660-7607193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7603038 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 155 (V155I)
Ref Sequence ENSEMBL: ENSMUSP00000124610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079902] [ENSMUST00000099729] [ENSMUST00000159983]
Predicted Effect probably damaging
Transcript: ENSMUST00000079902
AA Change: V155I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078824
Gene: ENSMUSG00000024972
AA Change: V155I

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 181 301 3.6e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099729
AA Change: V155I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097318
Gene: ENSMUSG00000024972
AA Change: V155I

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159983
AA Change: V155I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124610
Gene: ENSMUSG00000024972
AA Change: V155I

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Meta Mutation Damage Score 0.1010 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lipolysis, reduced adiposity, and enhanced insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Lgals12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Lgals12 APN 19 7606654 splice site probably benign
IGL02630:Lgals12 APN 19 7601242 splice site probably benign
IGL02700:Lgals12 APN 19 7598090 missense probably benign 0.01
R1398:Lgals12 UTSW 19 7603957 splice site probably benign
R1421:Lgals12 UTSW 19 7606714 missense probably benign 0.08
R1548:Lgals12 UTSW 19 7604312 missense probably benign 0.12
R1697:Lgals12 UTSW 19 7604165 missense possibly damaging 0.91
R2075:Lgals12 UTSW 19 7598845 missense possibly damaging 0.81
R2192:Lgals12 UTSW 19 7601241 splice site probably null
R2253:Lgals12 UTSW 19 7606765 start gained probably benign
R4256:Lgals12 UTSW 19 7606716 missense possibly damaging 0.93
R4738:Lgals12 UTSW 19 7604099 missense probably benign 0.01
R5495:Lgals12 UTSW 19 7604130 missense probably damaging 1.00
R5810:Lgals12 UTSW 19 7606720 missense probably benign 0.00
R6139:Lgals12 UTSW 19 7604377 missense probably benign 0.07
R7414:Lgals12 UTSW 19 7603970 missense probably damaging 1.00
R8755:Lgals12 UTSW 19 7603980 missense possibly damaging 0.95
X0067:Lgals12 UTSW 19 7603964 splice site probably null
Z1177:Lgals12 UTSW 19 7598080 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCCAAGCAGAAAGATTCCTGCCC -3'
(R):5'- AGTTTATCTGTGCAATGCACCTGCC -3'

Sequencing Primer
(F):5'- ACTTCTGACACAGTTTTGCAC -3'
(R):5'- AATGCACCTGCCTTGCAATG -3'
Posted On2013-04-11