Incidental Mutation 'R0517:Myh10'
ID 215998
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Name myosin, heavy polypeptide 10, non-muscle
Synonyms 5730504C04Rik, Fltn, Fltn, myosin IIB, 9330167F11Rik, Myhn-2, Myosin IIB, Myhn2, SMemb, NMHC-B, nonmuscle myosin heavy chain II-B, NMHC II-B, nonmuscle myosin heavy chain IIB
MMRRC Submission 038710-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0517 (G1)
Quality Score 69
Status Validated
Chromosome 11
Chromosomal Location 68582385-68707458 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 68702425 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
AlphaFold Q61879
Predicted Effect probably null
Transcript: ENSMUST00000018887
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092984
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102611
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139059
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 37,292,024 (GRCm39) probably benign Het
Acer1 T C 17: 57,262,569 (GRCm39) T194A probably benign Het
Adamts1 C A 16: 85,597,241 (GRCm39) D10Y possibly damaging Het
Adamts7 T C 9: 90,081,911 (GRCm39) V1612A probably benign Het
Adcyap1r1 T A 6: 55,468,282 (GRCm39) S373T probably damaging Het
Asic5 A T 3: 81,916,833 (GRCm39) I266F probably benign Het
Cacna1d A T 14: 29,901,232 (GRCm39) I274K probably damaging Het
Camsap2 G T 1: 136,221,126 (GRCm39) Q238K possibly damaging Het
Ceacam15 A C 7: 16,407,445 (GRCm39) L24* probably null Het
Cerk G A 15: 86,040,849 (GRCm39) T170I probably damaging Het
Cyp27b1 T C 10: 126,885,985 (GRCm39) probably null Het
Cyp2c65 T C 19: 39,070,792 (GRCm39) probably benign Het
Dennd5a A G 7: 109,533,968 (GRCm39) S75P probably damaging Het
Dhx9 C T 1: 153,354,662 (GRCm39) A146T possibly damaging Het
Dpysl5 A G 5: 30,935,410 (GRCm39) D171G probably damaging Het
Dsg3 A G 18: 20,662,082 (GRCm39) N449S probably benign Het
Eps8l3 T C 3: 107,790,776 (GRCm39) S189P probably benign Het
Exph5 A G 9: 53,284,062 (GRCm39) E381G probably benign Het
Fbxo46 A G 7: 18,870,799 (GRCm39) M473V possibly damaging Het
Fgf14 G A 14: 124,221,196 (GRCm39) P203S probably damaging Het
Foxf2 C T 13: 31,810,226 (GRCm39) A55V unknown Het
Galnt5 T G 2: 57,925,385 (GRCm39) probably benign Het
Glis2 T C 16: 4,429,416 (GRCm39) L181P probably damaging Het
Gm10000 T G 12: 104,442,667 (GRCm39) probably benign Het
Helz2 A G 2: 180,869,563 (GRCm39) S2959P probably benign Het
Hyal6 A G 6: 24,734,852 (GRCm39) N262D probably benign Het
Lgr4 T C 2: 109,841,665 (GRCm39) L526P probably damaging Het
Mapk1 A T 16: 16,833,910 (GRCm39) I88F probably benign Het
Mpg A T 11: 32,181,853 (GRCm39) H287L probably benign Het
Mpp4 A T 1: 59,163,886 (GRCm39) Y489* probably null Het
Mpzl1 T C 1: 165,429,359 (GRCm39) E224G probably damaging Het
Odad2 A C 18: 7,223,621 (GRCm39) L474R probably damaging Het
Or13p8 T A 4: 118,583,831 (GRCm39) I129K probably damaging Het
Or5m9 T C 2: 85,877,548 (GRCm39) S241P probably damaging Het
Paip1 T A 13: 119,584,326 (GRCm39) F196I probably damaging Het
Pde3a A T 6: 141,444,383 (GRCm39) K1064* probably null Het
Pira2 A T 7: 3,847,196 (GRCm39) probably benign Het
Pros1 A G 16: 62,723,881 (GRCm39) S210G probably benign Het
Rbm15 A T 3: 107,238,685 (GRCm39) L571Q probably damaging Het
Scn1a T A 2: 66,132,751 (GRCm39) T1194S possibly damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Serpina1e G A 12: 103,915,486 (GRCm39) T240I probably benign Het
Setx T G 2: 29,047,145 (GRCm39) S1874R probably benign Het
Sgsm2 G T 11: 74,758,477 (GRCm39) T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 (GRCm39) V300A probably damaging Het
Spata46 A G 1: 170,139,178 (GRCm39) Y59C probably damaging Het
Supt3 T C 17: 45,430,158 (GRCm39) F404L probably benign Het
Tars1 T A 15: 11,394,452 (GRCm39) K62* probably null Het
Tas2r139 A C 6: 42,118,425 (GRCm39) T186P probably damaging Het
Tasor2 T A 13: 3,616,964 (GRCm39) T2367S possibly damaging Het
Tc2n C T 12: 101,615,454 (GRCm39) S457N probably damaging Het
Tox4 A T 14: 52,530,085 (GRCm39) S582C probably benign Het
Trappc12 T C 12: 28,747,133 (GRCm39) probably benign Het
Ubqlnl G T 7: 103,797,845 (GRCm39) Q551K probably damaging Het
Ubr4 A G 4: 139,119,435 (GRCm39) T205A probably benign Het
Urb1 G A 16: 90,574,310 (GRCm39) Q924* probably null Het
Vmn1r49 A G 6: 90,049,720 (GRCm39) L94P probably damaging Het
Vmn2r120 T C 17: 57,815,949 (GRCm39) Y802C probably damaging Het
Xrcc1 C T 7: 24,269,744 (GRCm39) probably benign Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68,681,534 (GRCm39) missense probably benign 0.10
IGL01132:Myh10 APN 11 68,659,094 (GRCm39) missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68,702,629 (GRCm39) missense probably benign 0.04
IGL01404:Myh10 APN 11 68,642,866 (GRCm39) splice site probably null
IGL01409:Myh10 APN 11 68,698,045 (GRCm39) missense probably damaging 0.98
IGL01660:Myh10 APN 11 68,676,715 (GRCm39) missense probably benign 0.00
IGL02111:Myh10 APN 11 68,680,938 (GRCm39) missense probably damaging 1.00
IGL02481:Myh10 APN 11 68,692,994 (GRCm39) missense probably benign 0.00
IGL02483:Myh10 APN 11 68,692,994 (GRCm39) missense probably benign 0.00
IGL02502:Myh10 APN 11 68,705,198 (GRCm39) splice site probably null
IGL03178:Myh10 APN 11 68,590,239 (GRCm39) missense probably benign 0.19
algia UTSW 11 68,693,757 (GRCm39) missense probably damaging 1.00
itis UTSW 11 68,655,071 (GRCm39) missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68,655,918 (GRCm39) missense probably damaging 1.00
R0066:Myh10 UTSW 11 68,590,317 (GRCm39) missense probably damaging 1.00
R0066:Myh10 UTSW 11 68,590,317 (GRCm39) missense probably damaging 1.00
R0855:Myh10 UTSW 11 68,702,627 (GRCm39) missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68,682,676 (GRCm39) splice site probably benign
R1135:Myh10 UTSW 11 68,698,023 (GRCm39) missense probably benign
R1169:Myh10 UTSW 11 68,653,667 (GRCm39) missense probably damaging 0.99
R1643:Myh10 UTSW 11 68,682,836 (GRCm39) missense probably damaging 0.96
R1733:Myh10 UTSW 11 68,693,122 (GRCm39) missense probably benign 0.06
R1754:Myh10 UTSW 11 68,703,884 (GRCm39) missense probably damaging 0.98
R1859:Myh10 UTSW 11 68,636,239 (GRCm39) missense probably benign 0.03
R1898:Myh10 UTSW 11 68,662,732 (GRCm39) missense probably damaging 1.00
R1905:Myh10 UTSW 11 68,662,694 (GRCm39) splice site probably benign
R1914:Myh10 UTSW 11 68,681,034 (GRCm39) missense probably damaging 0.99
R1915:Myh10 UTSW 11 68,681,034 (GRCm39) missense probably damaging 0.99
R1987:Myh10 UTSW 11 68,705,322 (GRCm39) missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68,698,115 (GRCm39) splice site probably benign
R2132:Myh10 UTSW 11 68,698,115 (GRCm39) splice site probably benign
R2136:Myh10 UTSW 11 68,695,540 (GRCm39) missense probably damaging 1.00
R2214:Myh10 UTSW 11 68,673,953 (GRCm39) missense probably damaging 1.00
R2351:Myh10 UTSW 11 68,683,965 (GRCm39) missense probably damaging 1.00
R3407:Myh10 UTSW 11 68,681,037 (GRCm39) missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68,703,878 (GRCm39) missense probably damaging 0.99
R3908:Myh10 UTSW 11 68,661,885 (GRCm39) critical splice donor site probably null
R4275:Myh10 UTSW 11 68,642,766 (GRCm39) critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68,705,875 (GRCm39) missense probably benign 0.04
R4666:Myh10 UTSW 11 68,692,556 (GRCm39) critical splice donor site probably null
R4668:Myh10 UTSW 11 68,695,468 (GRCm39) missense probably damaging 1.00
R4750:Myh10 UTSW 11 68,676,140 (GRCm39) missense probably damaging 1.00
R4968:Myh10 UTSW 11 68,684,049 (GRCm39) missense probably damaging 1.00
R4977:Myh10 UTSW 11 68,689,197 (GRCm39) missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68,674,021 (GRCm39) missense probably damaging 1.00
R5288:Myh10 UTSW 11 68,692,434 (GRCm39) missense probably damaging 1.00
R5304:Myh10 UTSW 11 68,655,071 (GRCm39) missense probably damaging 0.96
R5366:Myh10 UTSW 11 68,651,518 (GRCm39) missense probably damaging 0.97
R5384:Myh10 UTSW 11 68,692,434 (GRCm39) missense probably damaging 1.00
R5427:Myh10 UTSW 11 68,693,757 (GRCm39) missense probably damaging 1.00
R5546:Myh10 UTSW 11 68,689,206 (GRCm39) missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68,659,113 (GRCm39) missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68,676,685 (GRCm39) missense probably damaging 1.00
R5995:Myh10 UTSW 11 68,705,809 (GRCm39) missense probably benign 0.01
R6021:Myh10 UTSW 11 68,699,688 (GRCm39) missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68,682,716 (GRCm39) missense probably damaging 1.00
R6179:Myh10 UTSW 11 68,692,979 (GRCm39) missense probably damaging 0.98
R6263:Myh10 UTSW 11 68,701,058 (GRCm39) missense probably damaging 0.98
R6264:Myh10 UTSW 11 68,636,241 (GRCm39) missense probably benign 0.01
R6484:Myh10 UTSW 11 68,590,293 (GRCm39) missense probably damaging 1.00
R6575:Myh10 UTSW 11 68,699,676 (GRCm39) missense probably benign 0.00
R6736:Myh10 UTSW 11 68,636,165 (GRCm39) missense probably damaging 1.00
R7141:Myh10 UTSW 11 68,692,965 (GRCm39) missense probably benign
R7256:Myh10 UTSW 11 68,681,515 (GRCm39) missense probably damaging 1.00
R7329:Myh10 UTSW 11 68,701,017 (GRCm39) missense probably benign 0.44
R7363:Myh10 UTSW 11 68,705,874 (GRCm39) missense probably benign
R7576:Myh10 UTSW 11 68,692,992 (GRCm39) missense probably damaging 1.00
R7577:Myh10 UTSW 11 68,636,806 (GRCm39) missense unknown
R7681:Myh10 UTSW 11 68,662,762 (GRCm39) missense probably damaging 0.98
R7813:Myh10 UTSW 11 68,676,735 (GRCm39) missense probably benign 0.00
R7834:Myh10 UTSW 11 68,676,652 (GRCm39) missense probably damaging 1.00
R7922:Myh10 UTSW 11 68,699,719 (GRCm39) missense possibly damaging 0.56
R7938:Myh10 UTSW 11 68,583,327 (GRCm39) missense unknown
R7958:Myh10 UTSW 11 68,612,173 (GRCm39) missense probably benign 0.00
R7994:Myh10 UTSW 11 68,681,070 (GRCm39) critical splice donor site probably null
R8395:Myh10 UTSW 11 68,682,842 (GRCm39) missense probably damaging 0.98
R8523:Myh10 UTSW 11 68,688,235 (GRCm39) missense probably benign 0.01
R8674:Myh10 UTSW 11 68,705,257 (GRCm39) missense probably damaging 0.98
R8816:Myh10 UTSW 11 68,693,778 (GRCm39) missense probably damaging 0.97
R8912:Myh10 UTSW 11 68,680,929 (GRCm39) critical splice acceptor site probably null
R9057:Myh10 UTSW 11 68,656,011 (GRCm39) missense possibly damaging 0.82
R9333:Myh10 UTSW 11 68,680,980 (GRCm39) missense probably benign 0.12
R9586:Myh10 UTSW 11 68,703,820 (GRCm39) missense possibly damaging 0.56
R9617:Myh10 UTSW 11 68,682,815 (GRCm39) missense probably benign 0.21
X0028:Myh10 UTSW 11 68,683,961 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCAGCAGAGAGGTCACCACAG -3'
(R):5'- TCAGTGTGTCCACCTACAAGAGGAG -3'

Sequencing Primer
(F):5'- AGGTCACCACAGTGGTTCAG -3'
(R):5'- GGAGGTCAGATAACCTGTGC -3'
Posted On 2014-07-16