Mutagenetix > Incidental Mutation

Incidental Mutation 'R0586:9530053A07Rik'

216002

Institutional Source

Beutler Lab

Gene Symbol

9530053A07Rik

Ensembl Gene

ENSMUSG00000078776

Gene Name

RIKEN cDNA 9530053A07 gene

Synonyms

MMRRC Submission

038776-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R0586 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

28129466-28164811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28137091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 145 (V145D)

Ref Sequence

ENSEMBL: ENSMUSP00000114986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]

AlphaFold

E9PVG8

Predicted Effect

probably damaging
Transcript: ENSMUST00000059886
AA Change: V145D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: V145D

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130693

Predicted Effect

probably damaging
Transcript: ENSMUST00000150948
AA Change: V145D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: V145D

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Meta Mutation Damage Score

0.4637

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.5%
20x: 94.4%

Validation Efficiency

100% (74/74)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	T	4: 53,092,860	V308E	probably benign	Het
Amy1	A	G	3: 113,562,769		probably benign	Het
Astn2	C	T	4: 66,185,142	V345M	unknown	Het
Brwd1	T	C	16: 96,043,086	E756G	probably damaging	Het
Ccpg1	C	T	9: 73,001,821	L135F	probably benign	Het
Cecr2	C	T	6: 120,757,884	H694Y	probably damaging	Het
Cfh	G	A	1: 140,183,182	T14I	probably damaging	Het
Cfhr2	G	A	1: 139,813,434	R268*	probably null	Het
Clca1	T	A	3: 145,032,589	I53L	probably benign	Het
Clcn6	A	G	4: 148,038,749		probably benign	Het
Cnfn	C	T	7: 25,367,831	V98I	probably benign	Het
Cntnap1	C	T	11: 101,187,014	R1122W	probably damaging	Het
Cpne9	A	T	6: 113,295,063	E384V	probably damaging	Het
Ctr9	T	C	7: 111,049,498		probably benign	Het
Ctsj	T	A	13: 61,003,701		probably benign	Het
Cyp2c39	A	C	19: 39,513,490		probably benign	Het
Dock5	A	C	14: 67,809,032	I767S	probably damaging	Het
Eftud2	T	C	11: 102,846,620	T552A	probably damaging	Het
Epdr1	A	G	13: 19,594,545	I25T	probably damaging	Het
Fam160a2	T	C	7: 105,389,447	E195G	probably damaging	Het
Fam208b	A	G	13: 3,590,321	L272P	probably damaging	Het
Fcgbp	A	T	7: 28,089,713	D568V	probably damaging	Het
Frem2	T	A	3: 53,647,921	T1732S	probably damaging	Het
Fuz	T	C	7: 44,898,558	V183A	possibly damaging	Het
Grb7	T	C	11: 98,453,220	S284P	probably damaging	Het
Hoxb4	G	T	11: 96,318,887	G40C	probably damaging	Het
Kcnn1	T	C	8: 70,863,869		probably benign	Het
Kmt2d	C	A	15: 98,835,207		probably benign	Het
L3mbtl3	A	G	10: 26,327,834	V366A	unknown	Het
Ldlr	G	A	9: 21,739,744	R486H	probably benign	Het
Lnpep	A	T	17: 17,575,396		probably benign	Het
Mical3	A	T	6: 121,029,641		probably benign	Het
Myh15	T	C	16: 49,171,887		probably benign	Het
Nup155	T	A	15: 8,130,232	H542Q	probably benign	Het
Olfr1100	T	C	2: 86,978,782	N5D	probably damaging	Het
Olfr1240	T	A	2: 89,439,354	R308S	possibly damaging	Het
Olfr53	T	C	7: 140,652,063	F28S	probably benign	Het
Olfr780	A	G	10: 129,322,047	I141M	probably benign	Het
Olfr967	A	T	9: 39,751,118	H244L	probably damaging	Het
Opn4	A	G	14: 34,598,973		probably benign	Het
Pak3	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	X: 143,743,893		probably benign	Het
Parp14	T	C	16: 35,841,012	K1522R	probably benign	Het
Pkhd1	A	T	1: 20,524,111	D1259E	probably benign	Het
Pogz	C	T	3: 94,879,353	A1084V	probably damaging	Het
Popdc3	G	A	10: 45,315,263	V157M	probably benign	Het
Prrt4	T	C	6: 29,171,184	Y423C	probably damaging	Het
Qrich1	C	T	9: 108,534,520	H415Y	probably damaging	Het
Rabgap1	A	G	2: 37,543,223	N801D	probably benign	Het
Rb1	A	G	14: 73,287,684		probably benign	Het
Rp1	A	T	1: 4,347,837	N1017K	possibly damaging	Het
Ryr2	T	C	13: 11,635,559	D356G	probably null	Het
Skint8	C	G	4: 111,936,929	P172R	probably damaging	Het
Slc12a8	T	G	16: 33,658,230	M643R	possibly damaging	Het
Sult1c1	A	T	17: 53,964,085		probably benign	Het
Tcaf1	T	A	6: 42,673,539	M869L	probably damaging	Het
Tecpr1	T	C	5: 144,217,401	N78S	probably damaging	Het
Tectb	A	T	19: 55,181,924	Y69F	probably damaging	Het
Them4	A	T	3: 94,329,794	N187I	possibly damaging	Het
Tm9sf3	A	G	19: 41,256,143		probably null	Het
Tnik	G	T	3: 28,577,361		probably benign	Het
Tns2	G	T	15: 102,109,585		probably benign	Het
Tnxb	A	G	17: 34,672,144	D487G	probably damaging	Het
Trim33	T	A	3: 103,310,344	C202S	probably damaging	Het
Trpm2	T	A	10: 77,923,516	I1145F	probably damaging	Het
Trpv2	A	G	11: 62,592,770	T478A	probably benign	Het
Ube2e3	T	C	2: 78,919,990	Y187H	probably benign	Het
Ubxn11	A	G	4: 134,109,652	R64G	possibly damaging	Het
Wwtr1	T	C	3: 57,459,066	T407A	probably damaging	Het
Zfyve26	A	T	12: 79,268,728	S1325T	possibly damaging	Het

Other mutations in 9530053A07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:9530053A07Rik	APN	7	28164528	missense	probably damaging	1.00
IGL00757:9530053A07Rik	APN	7	28154445	missense	probably damaging	1.00
IGL01015:9530053A07Rik	APN	7	28155318	missense	probably damaging	1.00
IGL01079:9530053A07Rik	APN	7	28139778	missense	probably damaging	0.99
IGL01343:9530053A07Rik	APN	7	28150702	missense	probably benign	0.19
IGL01420:9530053A07Rik	APN	7	28140133	missense	probably benign	0.28
IGL01604:9530053A07Rik	APN	7	28155324	missense	probably benign	0.11
IGL01666:9530053A07Rik	APN	7	28153292	missense	probably damaging	1.00
IGL02002:9530053A07Rik	APN	7	28152796	missense	probably damaging	1.00
IGL02036:9530053A07Rik	APN	7	28137525	missense	possibly damaging	0.82
IGL02126:9530053A07Rik	APN	7	28139856	missense	probably damaging	1.00
IGL02150:9530053A07Rik	APN	7	28146779	nonsense	probably null
IGL02219:9530053A07Rik	APN	7	28154635	missense	probably damaging	1.00
IGL02563:9530053A07Rik	APN	7	28157892	missense	probably benign
IGL02804:9530053A07Rik	APN	7	28153370	missense	probably benign	0.00
IGL02830:9530053A07Rik	APN	7	28162923	missense	probably damaging	1.00
IGL02943:9530053A07Rik	APN	7	28147188	missense	probably damaging	1.00
IGL02977:9530053A07Rik	APN	7	28164372	missense	possibly damaging	0.83
IGL03231:9530053A07Rik	APN	7	28153722	missense	possibly damaging	0.95
IGL03304:9530053A07Rik	APN	7	28142242	missense	probably damaging	0.99
herz	UTSW	7	28153839	missense	possibly damaging	0.72
pulse	UTSW	7	28153749	missense	probably damaging	1.00
Sinusoidal	UTSW	7	28140130	missense	probably damaging	1.00
PIT4378001:9530053A07Rik	UTSW	7	28154464	missense	possibly damaging	0.61
R0023:9530053A07Rik	UTSW	7	28153412	missense	probably benign	0.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0132:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0158:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R0230:9530053A07Rik	UTSW	7	28156825	missense	probably damaging	1.00
R0310:9530053A07Rik	UTSW	7	28142274	missense	probably benign	0.04
R0448:9530053A07Rik	UTSW	7	28140235	missense	probably benign	0.03
R0462:9530053A07Rik	UTSW	7	28137340	missense	probably damaging	1.00
R0481:9530053A07Rik	UTSW	7	28153749	missense	probably damaging	1.00
R0497:9530053A07Rik	UTSW	7	28147465	missense	probably damaging	1.00
R0556:9530053A07Rik	UTSW	7	28159378	missense	probably benign
R0562:9530053A07Rik	UTSW	7	28162690	missense	probably benign	0.30
R0924:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R0930:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R1103:9530053A07Rik	UTSW	7	28154520	missense	probably damaging	1.00
R1213:9530053A07Rik	UTSW	7	28157673	missense	probably damaging	1.00
R1292:9530053A07Rik	UTSW	7	28142794	splice site	probably benign
R1368:9530053A07Rik	UTSW	7	28159478	missense	possibly damaging	0.89
R1451:9530053A07Rik	UTSW	7	28137157	missense	probably damaging	1.00
R1477:9530053A07Rik	UTSW	7	28157093	missense	probably benign	0.01
R1538:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R1655:9530053A07Rik	UTSW	7	28147110	missense	probably damaging	0.98
R1697:9530053A07Rik	UTSW	7	28154347	missense	probably damaging	1.00
R1741:9530053A07Rik	UTSW	7	28157854	missense	probably damaging	0.98
R1796:9530053A07Rik	UTSW	7	28155372	missense	probably damaging	1.00
R1853:9530053A07Rik	UTSW	7	28155546	nonsense	probably null
R1861:9530053A07Rik	UTSW	7	28154732	missense	probably damaging	1.00
R1909:9530053A07Rik	UTSW	7	28144348	missense	possibly damaging	0.52
R1971:9530053A07Rik	UTSW	7	28131512	missense	possibly damaging	0.90
R1990:9530053A07Rik	UTSW	7	28154360	missense	probably damaging	0.98
R2020:9530053A07Rik	UTSW	7	28155594	missense	probably benign
R2084:9530053A07Rik	UTSW	7	28157535	missense	probably damaging	1.00
R2125:9530053A07Rik	UTSW	7	28158022	missense	probably benign	0.00
R2132:9530053A07Rik	UTSW	7	28155474	missense	probably damaging	1.00
R2513:9530053A07Rik	UTSW	7	28131635	missense	probably damaging	0.99
R2913:9530053A07Rik	UTSW	7	28164307	missense	probably damaging	1.00
R3150:9530053A07Rik	UTSW	7	28154195	missense	probably benign	0.21
R3499:9530053A07Rik	UTSW	7	28154555	missense	probably benign	0.42
R3702:9530053A07Rik	UTSW	7	28157778	missense	probably damaging	1.00
R3881:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R3938:9530053A07Rik	UTSW	7	28154294	missense	probably damaging	1.00
R4050:9530053A07Rik	UTSW	7	28152985	missense	possibly damaging	0.55
R4152:9530053A07Rik	UTSW	7	28156897	missense	possibly damaging	0.47
R4168:9530053A07Rik	UTSW	7	28137109	missense	probably benign	0.05
R4235:9530053A07Rik	UTSW	7	28156648	missense	probably damaging	0.99
R4241:9530053A07Rik	UTSW	7	28154335	missense	probably damaging	1.00
R4363:9530053A07Rik	UTSW	7	28146906	missense	probably damaging	1.00
R4460:9530053A07Rik	UTSW	7	28152856	missense	probably benign	0.17
R4463:9530053A07Rik	UTSW	7	28150719	missense	probably benign
R4841:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4842:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4876:9530053A07Rik	UTSW	7	28142800	intron	probably benign
R4905:9530053A07Rik	UTSW	7	28156983	missense	possibly damaging	0.93
R4997:9530053A07Rik	UTSW	7	28143924	missense	possibly damaging	0.77
R5091:9530053A07Rik	UTSW	7	28156958	missense	probably benign	0.44
R5159:9530053A07Rik	UTSW	7	28153308	missense	probably benign	0.09
R5326:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5396:9530053A07Rik	UTSW	7	28140183	missense	probably benign
R5441:9530053A07Rik	UTSW	7	28156914	missense	probably damaging	1.00
R5480:9530053A07Rik	UTSW	7	28157999	nonsense	probably null
R5542:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5571:9530053A07Rik	UTSW	7	28156569	missense	probably damaging	0.99
R5613:9530053A07Rik	UTSW	7	28142878	intron	probably benign
R5637:9530053A07Rik	UTSW	7	28152852	missense	probably benign	0.00
R5766:9530053A07Rik	UTSW	7	28137329	nonsense	probably null
R6174:9530053A07Rik	UTSW	7	28139959	missense	probably damaging	0.96
R6233:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R6250:9530053A07Rik	UTSW	7	28150714	missense	probably damaging	1.00
R6379:9530053A07Rik	UTSW	7	28157592	missense	probably damaging	1.00
R6442:9530053A07Rik	UTSW	7	28144186	missense	possibly damaging	0.88
R6478:9530053A07Rik	UTSW	7	28155373	missense	probably damaging	1.00
R6699:9530053A07Rik	UTSW	7	28144368	missense	probably damaging	1.00
R6852:9530053A07Rik	UTSW	7	28147135	missense	probably damaging	1.00
R6883:9530053A07Rik	UTSW	7	28152835	missense	possibly damaging	0.89
R6902:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6903:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6904:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6992:9530053A07Rik	UTSW	7	28140183	missense	probably benign	0.04
R7023:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R7039:9530053A07Rik	UTSW	7	28140148	missense	possibly damaging	0.80
R7171:9530053A07Rik	UTSW	7	28154519	nonsense	probably null
R7282:9530053A07Rik	UTSW	7	28144408	missense	probably benign	0.02
R7291:9530053A07Rik	UTSW	7	28140220	missense	probably benign
R7344:9530053A07Rik	UTSW	7	28140279	missense	possibly damaging	0.79
R7344:9530053A07Rik	UTSW	7	28152760	missense	possibly damaging	0.46
R7392:9530053A07Rik	UTSW	7	28164372	missense	possibly damaging	0.83
R7531:9530053A07Rik	UTSW	7	28140231	missense	probably benign
R7541:9530053A07Rik	UTSW	7	28144256	nonsense	probably null
R7577:9530053A07Rik	UTSW	7	28154423	missense	possibly damaging	0.65
R7594:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R7647:9530053A07Rik	UTSW	7	28140045	missense	probably benign	0.00
R7718:9530053A07Rik	UTSW	7	28147201	missense	probably damaging	1.00
R7733:9530053A07Rik	UTSW	7	28139965	missense	probably damaging	1.00
R7737:9530053A07Rik	UTSW	7	28157073	missense	probably damaging	1.00
R7908:9530053A07Rik	UTSW	7	28147496	missense	probably benign	0.12
R8013:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8014:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8151:9530053A07Rik	UTSW	7	28153341	missense	possibly damaging	0.95
R8175:9530053A07Rik	UTSW	7	28164448	nonsense	probably null
R8254:9530053A07Rik	UTSW	7	28147349	missense	possibly damaging	0.63
R8345:9530053A07Rik	UTSW	7	28155360	missense	probably damaging	1.00
R8414:9530053A07Rik	UTSW	7	28142733	missense	probably damaging	1.00
R8419:9530053A07Rik	UTSW	7	28143921	missense	probably damaging	1.00
R8496:9530053A07Rik	UTSW	7	28143952	missense	possibly damaging	0.81
R8691:9530053A07Rik	UTSW	7	28153839	missense	possibly damaging	0.72
R8785:9530053A07Rik	UTSW	7	28154707	missense	probably damaging	1.00
R8863:9530053A07Rik	UTSW	7	28131581	missense	probably damaging	1.00
R8926:9530053A07Rik	UTSW	7	28154444	missense	probably damaging	1.00
R8950:9530053A07Rik	UTSW	7	28164326	missense	probably benign	0.32
R9014:9530053A07Rik	UTSW	7	28155451	missense	probably damaging	1.00
R9045:9530053A07Rik	UTSW	7	28154431	missense	probably damaging	1.00
R9115:9530053A07Rik	UTSW	7	28154329	missense	possibly damaging	0.74
R9233:9530053A07Rik	UTSW	7	28140094	missense	possibly damaging	0.83
R9330:9530053A07Rik	UTSW	7	28156985	missense	probably benign	0.02
R9426:9530053A07Rik	UTSW	7	28143856	missense	possibly damaging	0.92
R9477:9530053A07Rik	UTSW	7	28152840	missense	probably damaging	1.00
R9502:9530053A07Rik	UTSW	7	28137466	missense	probably benign	0.09
R9505:9530053A07Rik	UTSW	7	28142484	nonsense	probably null
R9601:9530053A07Rik	UTSW	7	28154380	missense	possibly damaging	0.78
R9630:9530053A07Rik	UTSW	7	28137199	missense	probably damaging	1.00
R9632:9530053A07Rik	UTSW	7	28142301	missense	probably benign
R9673:9530053A07Rik	UTSW	7	28156619	missense	probably benign	0.25
R9735:9530053A07Rik	UTSW	7	28157010	missense	probably damaging	1.00
Z1176:9530053A07Rik	UTSW	7	28142386	missense	probably benign	0.06
Z1176:9530053A07Rik	UTSW	7	28154762	missense	probably benign	0.03
Z1177:9530053A07Rik	UTSW	7	28139898	missense	probably benign	0.25
Z1186:9530053A07Rik	UTSW	7	28131572	missense	probably benign
Z1186:9530053A07Rik	UTSW	7	28146705	missense	probably benign	0.00
Z1186:9530053A07Rik	UTSW	7	28156986	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGTAATGAGCCTGCCGTTCTGCC -3'
(R):5'- TTATAGTTGCCGCACAGCCCAGAC -3'

Sequencing Primer
(F):5'- acattgttggggaggggg -3'
(R):5'- AGACACCTGGTCTTGGAAGC -3'

Posted On

2014-07-16