Incidental Mutation 'R0015:Dync1i2'
Institutional Source Beutler Lab
Gene Symbol Dync1i2
Ensembl Gene ENSMUSG00000027012
Gene Namedynein cytoplasmic 1 intermediate chain 2
Synonyms3110079H08Rik, Dncic2
MMRRC Submission 038310-MU
Accession Numbers

Genbank: NM_010064; MGI: 107750

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R0015 (G1)
Quality Score32
Status Validated
Chromosomal Location71211706-71263303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71214484 bp
Amino Acid Change Arginine to Serine at position 13 (R13S)
Ref Sequence ENSEMBL: ENSMUSP00000107772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081710] [ENSMUST00000100028] [ENSMUST00000112136] [ENSMUST00000112138] [ENSMUST00000112139] [ENSMUST00000112140] [ENSMUST00000112142] [ENSMUST00000112144]
Predicted Effect probably damaging
Transcript: ENSMUST00000081710
AA Change: R13S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080410
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100028
AA Change: R13S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097605
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112136
AA Change: R13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107764
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 5e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 618 632 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112138
AA Change: R13S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107766
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112139
AA Change: R13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107767
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 4.5e-21 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 592 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112140
AA Change: R13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107768
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112142
AA Change: R13S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107770
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112144
AA Change: R13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107772
Gene: ENSMUSG00000027012
AA Change: R13S

coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 133 163 6.5e-19 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149735
Meta Mutation Damage Score 0.1320 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit a trend towards slight locomotor deficit. [provided by MGI curators]
Allele List at MGI

All alleles(50) : Targeted, other(2) Gene trapped(48)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Dync1i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Dync1i2 APN 2 71247955 splice site probably benign
IGL01609:Dync1i2 APN 2 71247008 splice site probably benign
IGL02479:Dync1i2 APN 2 71235979 missense probably damaging 1.00
IGL02545:Dync1i2 APN 2 71262751 missense possibly damaging 0.95
3-1:Dync1i2 UTSW 2 71247828 missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71214484 missense probably damaging 1.00
R0437:Dync1i2 UTSW 2 71227825 critical splice acceptor site probably null
R0555:Dync1i2 UTSW 2 71214518 frame shift probably null
R0835:Dync1i2 UTSW 2 71250972 missense probably damaging 1.00
R1146:Dync1i2 UTSW 2 71227820 splice site probably benign
R1452:Dync1i2 UTSW 2 71249863 splice site probably benign
R1662:Dync1i2 UTSW 2 71250979 missense possibly damaging 0.87
R1765:Dync1i2 UTSW 2 71249415 missense probably benign
R2059:Dync1i2 UTSW 2 71249853 critical splice donor site probably null
R2145:Dync1i2 UTSW 2 71214563 splice site probably benign
R2233:Dync1i2 UTSW 2 71249420 nonsense probably null
R2234:Dync1i2 UTSW 2 71249420 nonsense probably null
R2235:Dync1i2 UTSW 2 71249420 nonsense probably null
R3151:Dync1i2 UTSW 2 71233716 splice site probably benign
R3916:Dync1i2 UTSW 2 71249372 missense probably damaging 1.00
R4653:Dync1i2 UTSW 2 71247855 missense probably damaging 1.00
R4720:Dync1i2 UTSW 2 71233674 missense probably damaging 1.00
R4920:Dync1i2 UTSW 2 71247324 missense probably damaging 1.00
R5574:Dync1i2 UTSW 2 71233650 missense probably benign 0.15
R5620:Dync1i2 UTSW 2 71258139 missense probably benign 0.00
R5677:Dync1i2 UTSW 2 71228623 missense probably benign 0.00
R5711:Dync1i2 UTSW 2 71250982 missense probably benign 0.31
R6730:Dync1i2 UTSW 2 71247140 missense probably benign 0.18
R6911:Dync1i2 UTSW 2 71247102 missense probably benign
R7140:Dync1i2 UTSW 2 71247939 missense probably benign 0.03
R7257:Dync1i2 UTSW 2 71249356 missense possibly damaging 0.92
R7460:Dync1i2 UTSW 2 71250886 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagataggagaatcgccatgag -3'
Posted On2014-07-17