Incidental Mutation 'R0015:Myh7b'
ID216011
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0015 (G1)
Quality Score53
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155622286 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 569 (P569L)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092995]
Predicted Effect probably damaging
Transcript: ENSMUST00000092995
AA Change: P569L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: P569L

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102357
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
irrational UTSW 2 155630672 unclassified probably benign
muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5161:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTACACACATAGGCGGGGAAG -3'
(R):5'- GCCCACGATGCTATAAGGAACCTAC -3'

Sequencing Primer
(F):5'- TTGTGGACCTGAAACAGCTC -3'
(R):5'- TACAAAGAAAAATATTGACCCAGGTG -3'
Posted On2014-07-17