Incidental Mutation 'R0015:Ppp1r3a'
ID 216016
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 038310-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0015 (G1)
Quality Score 79
Status Validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14717660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1085 (S1085P)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect possibly damaging
Transcript: ENSMUST00000045096
AA Change: S1085P

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: S1085P

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Meta Mutation Damage Score 0.0675 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130050O07Rik A G 1: 137,856,394 (GRCm39) Y23C unknown Het
Adcy3 G A 12: 4,245,260 (GRCm39) probably null Het
Aldh6a1 G A 12: 84,488,554 (GRCm39) L86F probably damaging Het
Arl10 G T 13: 54,723,770 (GRCm39) probably benign Het
Armc3 A G 2: 19,301,132 (GRCm39) probably null Het
Astn2 T G 4: 66,184,619 (GRCm39) probably null Het
Cacna1d G A 14: 29,836,928 (GRCm39) T804I probably benign Het
Ccny A C 18: 9,316,682 (GRCm39) probably benign Het
Cdh5 C T 8: 104,867,559 (GRCm39) T612I probably benign Het
Cfap58 A G 19: 48,017,539 (GRCm39) M800V probably benign Het
Clrn1 A T 3: 58,753,848 (GRCm39) I171K probably damaging Het
Cnp T A 11: 100,469,734 (GRCm39) probably null Het
Col12a1 T C 9: 79,558,667 (GRCm39) T1933A probably damaging Het
Cplane1 G A 15: 8,215,668 (GRCm39) R408H probably damaging Het
Cwf19l2 A G 9: 3,454,666 (GRCm39) S660G probably benign Het
Dync1i2 C A 2: 71,044,828 (GRCm39) R13S probably damaging Het
Eps8l1 A T 7: 4,480,556 (GRCm39) probably benign Het
Espn T C 4: 152,223,609 (GRCm39) T188A possibly damaging Het
F2 T C 2: 91,460,952 (GRCm39) E260G probably benign Het
Fat4 T A 3: 39,036,652 (GRCm39) S3435T probably damaging Het
Fchsd1 A G 18: 38,096,012 (GRCm39) C533R probably benign Het
Fstl5 G A 3: 76,229,498 (GRCm39) V100M probably damaging Het
Gls2 T G 10: 128,045,219 (GRCm39) L572R probably damaging Het
Gm20939 A T 17: 95,184,196 (GRCm39) E281D probably benign Het
Gpr35 T G 1: 92,910,954 (GRCm39) L222W probably damaging Het
Hsf5 C A 11: 87,548,161 (GRCm39) H615N probably benign Het
Id2 C T 12: 25,145,802 (GRCm39) D70N probably damaging Het
Ints2 T C 11: 86,140,113 (GRCm39) T240A probably damaging Het
Kcnn3 A C 3: 89,570,080 (GRCm39) D631A probably damaging Het
Klhdc8a A G 1: 132,230,743 (GRCm39) T203A probably damaging Het
Lama4 C T 10: 38,951,432 (GRCm39) T1059M possibly damaging Het
Lgals8 A G 13: 12,462,179 (GRCm39) L226P probably damaging Het
Lifr T A 15: 7,217,667 (GRCm39) probably null Het
Lonp1 T A 17: 56,925,406 (GRCm39) Q462L probably benign Het
Lypd1 A G 1: 125,838,175 (GRCm39) V48A possibly damaging Het
Mapkapk2 A G 1: 131,025,063 (GRCm39) I67T possibly damaging Het
Mbd3l1 A T 9: 18,396,154 (GRCm39) D93V probably benign Het
Mdh1b T C 1: 63,760,959 (GRCm39) probably benign Het
Myh7b C T 2: 155,464,206 (GRCm39) P569L probably damaging Het
Ncapd3 C A 9: 26,963,105 (GRCm39) A470E probably damaging Het
Ndrg2 A G 14: 52,147,902 (GRCm39) probably benign Het
Nprl2 A T 9: 107,421,618 (GRCm39) I209F probably damaging Het
Ntrk1 A G 3: 87,699,057 (GRCm39) probably benign Het
Olfm2 T C 9: 20,580,037 (GRCm39) E268G probably damaging Het
Or8b37 T A 9: 37,958,963 (GRCm39) Y148* probably null Het
Pcf11 T A 7: 92,307,525 (GRCm39) H881L probably benign Het
Pde10a A G 17: 9,196,029 (GRCm39) D640G probably damaging Het
Pde9a G A 17: 31,605,330 (GRCm39) probably null Het
Pianp G T 6: 124,978,503 (GRCm39) G236V probably damaging Het
Polr2g A G 19: 8,771,016 (GRCm39) I160T probably damaging Het
Pter G A 2: 13,005,811 (GRCm39) G328D probably damaging Het
Rad51 T A 2: 118,946,808 (GRCm39) M5K probably benign Het
Rbm43 T A 2: 51,815,679 (GRCm39) I181F probably benign Het
Rgs12 T C 5: 35,180,120 (GRCm39) probably benign Het
Rnf213 A C 11: 119,332,432 (GRCm39) D2547A possibly damaging Het
Slc20a2 C A 8: 23,025,361 (GRCm39) A21E probably damaging Het
Stab2 A G 10: 86,679,481 (GRCm39) S2503P probably benign Het
Sv2b A T 7: 74,775,389 (GRCm39) F479L probably damaging Het
Sybu T C 15: 44,536,896 (GRCm39) R349G probably damaging Het
Tead3 T C 17: 28,560,325 (GRCm39) Y2C probably damaging Het
Tnrc6c T A 11: 117,612,284 (GRCm39) N307K probably damaging Het
Ubxn11 C G 4: 133,843,336 (GRCm39) probably null Het
Ust T C 10: 8,205,829 (GRCm39) probably benign Het
Vmn2r116 T A 17: 23,620,823 (GRCm39) N852K probably benign Het
Zgrf1 T C 3: 127,349,046 (GRCm39) probably benign Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14,718,988 (GRCm39) missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTCACAGCCTGCTAAGGAGCAAC -3'
(R):5'- ACGCAGGAACTCGAAGCTCAAG -3'

Sequencing Primer
(F):5'- GTACCTAATTCCAACTTGACGTG -3'
(R):5'- CTCGAAGCTCAAGGCAGG -3'
Posted On 2014-07-17