Incidental Mutation 'R0040:Zfp106'
ID 216031
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Name zinc finger protein 106
Synonyms Cd-1, H3a, Sh3bp3, sirm
MMRRC Submission 038334-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0040 (G1)
Quality Score 30
Status Validated
Chromosome 2
Chromosomal Location 120337301-120394324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 120362094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1008 (K1008N)
Ref Sequence ENSEMBL: ENSMUSP00000128995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000055241
AA Change: K1031N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: K1031N

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135625
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149210
Predicted Effect unknown
Transcript: ENSMUST00000163384
AA Change: K148N
Predicted Effect probably damaging
Transcript: ENSMUST00000171215
AA Change: K1008N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: K1008N

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Meta Mutation Damage Score 0.1089 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Antxr2 G A 5: 98,086,284 (GRCm39) T441I possibly damaging Het
Apcs A G 1: 172,722,023 (GRCm39) Y108H probably benign Het
Atad5 A G 11: 79,988,840 (GRCm39) T666A probably benign Het
Atcay C T 10: 81,046,353 (GRCm39) probably null Het
Bahcc1 A G 11: 120,159,196 (GRCm39) D141G probably damaging Het
Ceacam10 A G 7: 24,477,689 (GRCm39) Y68C probably damaging Het
Cfap54 T A 10: 92,812,901 (GRCm39) Q1344L probably benign Het
Cyb5r4 A G 9: 86,948,795 (GRCm39) probably null Het
Cyp2b9 G T 7: 25,872,899 (GRCm39) S14I possibly damaging Het
Dusp12 A G 1: 170,708,226 (GRCm39) Y164H probably damaging Het
Eml2 T C 7: 18,930,539 (GRCm39) V373A possibly damaging Het
Fat1 A G 8: 45,479,441 (GRCm39) D2829G probably damaging Het
Fbxl13 T C 5: 21,691,371 (GRCm39) T671A probably damaging Het
Fbxo28 G T 1: 182,153,805 (GRCm39) probably benign Het
Fbxo44 A G 4: 148,243,152 (GRCm39) L89P probably damaging Het
Fndc3b T A 3: 27,610,266 (GRCm39) probably null Het
Gm9955 G T 18: 24,842,209 (GRCm39) probably benign Het
Gprc6a T A 10: 51,491,080 (GRCm39) K819* probably null Het
Gxylt1 A T 15: 93,152,436 (GRCm39) probably benign Het
Hspa12a T C 19: 58,788,056 (GRCm39) T589A probably benign Het
Idh2 A G 7: 79,747,570 (GRCm39) S317P probably damaging Het
Ifi30 T C 8: 71,216,421 (GRCm39) probably null Het
Ifna16 G A 4: 88,594,867 (GRCm39) A76V probably benign Het
Itpr2 C T 6: 146,246,638 (GRCm39) E1127K probably damaging Het
Kank4 A G 4: 98,667,457 (GRCm39) V330A probably benign Het
Kpna1 T A 16: 35,843,611 (GRCm39) D328E probably damaging Het
Krt71 T A 15: 101,646,868 (GRCm39) H280L possibly damaging Het
Lrrc37 G A 11: 103,433,816 (GRCm39) P942S probably damaging Het
Mapt A G 11: 104,196,224 (GRCm39) M446V probably damaging Het
Med1 C T 11: 98,057,081 (GRCm39) probably null Het
Mif T A 10: 75,695,614 (GRCm39) H63L probably damaging Het
Mycbp2 A G 14: 103,461,708 (GRCm39) V1447A probably benign Het
Myo1b A T 1: 51,821,148 (GRCm39) I451N probably damaging Het
Nme2 A T 11: 93,842,756 (GRCm39) probably null Het
Nubp1 A G 16: 10,238,981 (GRCm39) T199A probably damaging Het
Nup210l T A 3: 90,089,212 (GRCm39) V1165D probably damaging Het
Nup98 T A 7: 101,841,241 (GRCm39) T122S probably damaging Het
Or14a258 A T 7: 86,035,715 (GRCm39) L51Q probably benign Het
Or1n2 T C 2: 36,797,470 (GRCm39) F171L probably damaging Het
Or5j1 C T 2: 86,879,548 (GRCm39) E11K probably damaging Het
Or6c202 T A 10: 128,996,608 (GRCm39) I82L probably benign Het
Pard3b A T 1: 62,676,979 (GRCm39) Y1170F probably damaging Het
Pear1 T C 3: 87,661,665 (GRCm39) D536G probably damaging Het
Phrf1 G T 7: 140,823,770 (GRCm39) R196L probably damaging Het
Plxna2 G T 1: 194,326,204 (GRCm39) R46L probably benign Het
Rbm39 G A 2: 155,990,099 (GRCm39) T496I possibly damaging Het
Rpl14 C G 9: 120,401,167 (GRCm39) F3L possibly damaging Het
Rtf2 G A 2: 172,286,616 (GRCm39) S40N probably damaging Het
Runx2 G A 17: 44,919,141 (GRCm39) S481L possibly damaging Het
Sh3rf1 T A 8: 61,782,286 (GRCm39) Y143N possibly damaging Het
Siglec15 G A 18: 78,092,092 (GRCm39) probably benign Het
Slc4a8 T A 15: 100,687,727 (GRCm39) I288N probably damaging Het
Ttc38 C A 15: 85,725,690 (GRCm39) F184L probably damaging Het
Vmn1r28 T C 6: 58,242,879 (GRCm39) Y241H probably damaging Het
Vmn2r110 A T 17: 20,816,346 (GRCm39) V59D probably benign Het
Wdpcp A G 11: 21,661,638 (GRCm39) I303M probably damaging Het
Zc3h12d G A 10: 7,743,678 (GRCm39) A483T probably benign Het
Zfp334 A G 2: 165,223,492 (GRCm39) Y184H probably benign Het
Zfp68 G A 5: 138,606,041 (GRCm39) T94I probably benign Het
Zkscan3 A T 13: 21,579,090 (GRCm39) probably null Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120,369,978 (GRCm39) missense probably benign 0.45
IGL00816:Zfp106 APN 2 120,357,329 (GRCm39) missense probably benign 0.02
IGL00822:Zfp106 APN 2 120,344,641 (GRCm39) missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120,343,208 (GRCm39) missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120,365,516 (GRCm39) missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120,354,945 (GRCm39) missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120,354,034 (GRCm39) missense probably benign 0.17
IGL01683:Zfp106 APN 2 120,355,036 (GRCm39) missense probably benign 0.00
IGL01809:Zfp106 APN 2 120,364,152 (GRCm39) missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120,365,288 (GRCm39) missense probably benign 0.26
IGL01960:Zfp106 APN 2 120,369,803 (GRCm39) missense probably benign 0.08
IGL01960:Zfp106 APN 2 120,354,524 (GRCm39) missense probably damaging 0.99
IGL02168:Zfp106 APN 2 120,364,712 (GRCm39) missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120,376,395 (GRCm39) splice site probably null
IGL02798:Zfp106 APN 2 120,340,991 (GRCm39) missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120,362,178 (GRCm39) missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120,359,120 (GRCm39) splice site probably benign
IGL03308:Zfp106 APN 2 120,354,505 (GRCm39) missense probably benign 0.00
IGL03324:Zfp106 APN 2 120,365,868 (GRCm39) missense probably benign 0.01
lepton UTSW 2 120,362,585 (GRCm39) missense probably damaging 0.98
Proton UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
quark UTSW 2 120,365,541 (GRCm39) nonsense probably null
R0040_zfp106_031 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
string UTSW 2 120,364,075 (GRCm39) missense probably damaging 0.96
theory UTSW 2 120,364,158 (GRCm39) nonsense probably null
R0040:Zfp106 UTSW 2 120,362,094 (GRCm39) missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120,350,968 (GRCm39) missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120,364,356 (GRCm39) missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120,358,953 (GRCm39) splice site probably null
R0558:Zfp106 UTSW 2 120,362,677 (GRCm39) missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120,357,497 (GRCm39) missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120,385,729 (GRCm39) missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120,366,084 (GRCm39) missense probably benign 0.00
R1124:Zfp106 UTSW 2 120,365,195 (GRCm39) missense probably benign 0.00
R1147:Zfp106 UTSW 2 120,351,017 (GRCm39) missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120,351,017 (GRCm39) missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120,354,560 (GRCm39) missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120,364,075 (GRCm39) missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120,364,158 (GRCm39) nonsense probably null
R1754:Zfp106 UTSW 2 120,364,245 (GRCm39) missense probably damaging 0.98
R1754:Zfp106 UTSW 2 120,364,244 (GRCm39) missense probably damaging 0.96
R1755:Zfp106 UTSW 2 120,365,656 (GRCm39) missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120,350,909 (GRCm39) missense probably benign 0.03
R1875:Zfp106 UTSW 2 120,344,096 (GRCm39) critical splice donor site probably null
R1903:Zfp106 UTSW 2 120,357,329 (GRCm39) missense probably benign 0.02
R1932:Zfp106 UTSW 2 120,362,162 (GRCm39) missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120,354,010 (GRCm39) missense probably benign 0.11
R2301:Zfp106 UTSW 2 120,366,131 (GRCm39) missense probably benign 0.04
R3429:Zfp106 UTSW 2 120,357,544 (GRCm39) missense probably benign 0.00
R3720:Zfp106 UTSW 2 120,365,080 (GRCm39) missense probably benign 0.01
R3875:Zfp106 UTSW 2 120,365,094 (GRCm39) missense probably benign 0.08
R3881:Zfp106 UTSW 2 120,362,630 (GRCm39) missense probably benign 0.01
R3921:Zfp106 UTSW 2 120,364,097 (GRCm39) missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120,365,337 (GRCm39) missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120,357,380 (GRCm39) splice site probably null
R4678:Zfp106 UTSW 2 120,364,221 (GRCm39) missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120,364,400 (GRCm39) missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120,341,015 (GRCm39) missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120,365,208 (GRCm39) missense probably benign 0.01
R5227:Zfp106 UTSW 2 120,354,449 (GRCm39) missense probably benign 0.11
R5328:Zfp106 UTSW 2 120,350,898 (GRCm39) missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120,365,262 (GRCm39) missense probably benign 0.02
R5624:Zfp106 UTSW 2 120,362,438 (GRCm39) missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120,363,988 (GRCm39) splice site probably null
R5691:Zfp106 UTSW 2 120,354,952 (GRCm39) missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120,346,487 (GRCm39) missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120,365,874 (GRCm39) missense probably benign 0.00
R6032:Zfp106 UTSW 2 120,365,874 (GRCm39) missense probably benign 0.00
R6298:Zfp106 UTSW 2 120,353,185 (GRCm39) missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120,362,585 (GRCm39) missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120,364,983 (GRCm39) missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120,365,541 (GRCm39) nonsense probably null
R6765:Zfp106 UTSW 2 120,369,935 (GRCm39) missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120,362,113 (GRCm39) missense probably damaging 0.99
R7453:Zfp106 UTSW 2 120,376,400 (GRCm39) splice site probably null
R7453:Zfp106 UTSW 2 120,341,008 (GRCm39) missense probably damaging 1.00
R7643:Zfp106 UTSW 2 120,343,215 (GRCm39) missense probably benign 0.01
R7829:Zfp106 UTSW 2 120,354,538 (GRCm39) missense possibly damaging 0.94
R7897:Zfp106 UTSW 2 120,366,096 (GRCm39) nonsense probably null
R7909:Zfp106 UTSW 2 120,344,700 (GRCm39) missense probably damaging 1.00
R8054:Zfp106 UTSW 2 120,355,000 (GRCm39) missense possibly damaging 0.93
R8124:Zfp106 UTSW 2 120,354,812 (GRCm39) missense probably benign 0.44
R8203:Zfp106 UTSW 2 120,349,559 (GRCm39) missense probably damaging 1.00
R8350:Zfp106 UTSW 2 120,366,099 (GRCm39) missense
R8450:Zfp106 UTSW 2 120,366,099 (GRCm39) missense
R8698:Zfp106 UTSW 2 120,354,600 (GRCm39) critical splice donor site probably null
R8985:Zfp106 UTSW 2 120,366,077 (GRCm39) missense
R9015:Zfp106 UTSW 2 120,364,019 (GRCm39) missense probably damaging 1.00
R9036:Zfp106 UTSW 2 120,369,906 (GRCm39) missense probably damaging 1.00
R9142:Zfp106 UTSW 2 120,350,935 (GRCm39) missense probably damaging 1.00
R9154:Zfp106 UTSW 2 120,364,812 (GRCm39) nonsense probably null
R9175:Zfp106 UTSW 2 120,353,197 (GRCm39) missense probably damaging 1.00
R9529:Zfp106 UTSW 2 120,351,007 (GRCm39) missense probably damaging 0.97
R9572:Zfp106 UTSW 2 120,349,559 (GRCm39) missense probably damaging 1.00
R9581:Zfp106 UTSW 2 120,365,807 (GRCm39) missense
RF008:Zfp106 UTSW 2 120,355,026 (GRCm39) small deletion probably benign
RF025:Zfp106 UTSW 2 120,355,026 (GRCm39) small deletion probably benign
X0025:Zfp106 UTSW 2 120,365,297 (GRCm39) missense probably benign
Z1088:Zfp106 UTSW 2 120,360,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAATTACTGCTGGGAGACCAC -3'
(R):5'- CATAATGCCTGTCATGCATTCAGCC -3'

Sequencing Primer
(F):5'- AGAGATGACTTCACACTTTCCTGG -3'
(R):5'- TGCATTCAGCCCGAGAC -3'
Posted On 2014-07-17