Incidental Mutation 'R0040:Zfp106'
ID216031
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Namezinc finger protein 106
SynonymsCd-1, H3a, Sh3bp3, sirm
MMRRC Submission 038334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0040 (G1)
Quality Score30
Status Validated
Chromosome2
Chromosomal Location120506820-120563843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120531613 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1008 (K1008N)
Ref Sequence ENSEMBL: ENSMUSP00000128995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
Predicted Effect probably damaging
Transcript: ENSMUST00000055241
AA Change: K1031N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: K1031N

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135625
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149210
Predicted Effect unknown
Transcript: ENSMUST00000163384
AA Change: K148N
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171215
AA Change: K1008N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: K1008N

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Meta Mutation Damage Score 0.1089 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,283,024 probably benign Het
Antxr2 G A 5: 97,938,425 T441I possibly damaging Het
Apcs A G 1: 172,894,456 Y108H probably benign Het
Atad5 A G 11: 80,098,014 T666A probably benign Het
Atcay C T 10: 81,210,519 probably null Het
Bahcc1 A G 11: 120,268,370 D141G probably damaging Het
Ceacam10 A G 7: 24,778,264 Y68C probably damaging Het
Cfap54 T A 10: 92,977,039 Q1344L probably benign Het
Cyb5r4 A G 9: 87,066,742 probably null Het
Cyp2b9 G T 7: 26,173,474 S14I possibly damaging Het
Dusp12 A G 1: 170,880,657 Y164H probably damaging Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fbxl13 T C 5: 21,486,373 T671A probably damaging Het
Fbxo28 G T 1: 182,326,240 probably benign Het
Fbxo44 A G 4: 148,158,695 L89P probably damaging Het
Fndc3b T A 3: 27,556,117 probably null Het
Gm884 G A 11: 103,542,990 P942S probably damaging Het
Gm9955 G T 18: 24,709,152 probably benign Het
Gprc6a T A 10: 51,614,984 K819* probably null Het
Gxylt1 A T 15: 93,254,555 probably benign Het
Hspa12a T C 19: 58,799,624 T589A probably benign Het
Idh2 A G 7: 80,097,822 S317P probably damaging Het
Ifi30 T C 8: 70,763,776 probably null Het
Ifna16 G A 4: 88,676,630 A76V probably benign Het
Itpr2 C T 6: 146,345,140 E1127K probably damaging Het
Kank4 A G 4: 98,779,220 V330A probably benign Het
Kpna1 T A 16: 36,023,241 D328E probably damaging Het
Krt71 T A 15: 101,738,433 H280L possibly damaging Het
Mapt A G 11: 104,305,398 M446V probably damaging Het
Med1 C T 11: 98,166,255 probably null Het
Mif T A 10: 75,859,780 H63L probably damaging Het
Mycbp2 A G 14: 103,224,272 V1447A probably benign Het
Myo1b A T 1: 51,781,989 I451N probably damaging Het
Nme2 A T 11: 93,951,930 probably null Het
Nubp1 A G 16: 10,421,117 T199A probably damaging Het
Nup210l T A 3: 90,181,905 V1165D probably damaging Het
Nup98 T A 7: 102,192,034 T122S probably damaging Het
Olfr1106 C T 2: 87,049,204 E11K probably damaging Het
Olfr304 A T 7: 86,386,507 L51Q probably benign Het
Olfr354 T C 2: 36,907,458 F171L probably damaging Het
Olfr771 T A 10: 129,160,739 I82L probably benign Het
Pard3b A T 1: 62,637,820 Y1170F probably damaging Het
Pear1 T C 3: 87,754,358 D536G probably damaging Het
Phrf1 G T 7: 141,243,857 R196L probably damaging Het
Plxna2 G T 1: 194,643,896 R46L probably benign Het
Rbm39 G A 2: 156,148,179 T496I possibly damaging Het
Rpl14 C G 9: 120,572,101 F3L possibly damaging Het
Rtf2 G A 2: 172,444,696 S40N probably damaging Het
Runx2 G A 17: 44,608,254 S481L possibly damaging Het
Sh3rf1 T A 8: 61,329,252 Y143N possibly damaging Het
Siglec15 G A 18: 78,048,877 probably benign Het
Slc4a8 T A 15: 100,789,846 I288N probably damaging Het
Ttc38 C A 15: 85,841,489 F184L probably damaging Het
Vmn1r28 T C 6: 58,265,894 Y241H probably damaging Het
Vmn2r110 A T 17: 20,596,084 V59D probably benign Het
Wdpcp A G 11: 21,711,638 I303M probably damaging Het
Zc3h12d G A 10: 7,867,914 A483T probably benign Het
Zfp334 A G 2: 165,381,572 Y184H probably benign Het
Zfp68 G A 5: 138,607,779 T94I probably benign Het
Zkscan3 A T 13: 21,394,920 probably null Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120539497 missense probably benign 0.45
IGL00816:Zfp106 APN 2 120526848 missense probably benign 0.02
IGL00822:Zfp106 APN 2 120514160 missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120512727 missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120535035 missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120524464 missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120523553 missense probably benign 0.17
IGL01683:Zfp106 APN 2 120524555 missense probably benign 0.00
IGL01809:Zfp106 APN 2 120533671 missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120534807 missense probably benign 0.26
IGL01960:Zfp106 APN 2 120524043 missense probably damaging 0.99
IGL01960:Zfp106 APN 2 120539322 missense probably benign 0.08
IGL02168:Zfp106 APN 2 120534231 missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120545914 splice site probably null
IGL02798:Zfp106 APN 2 120510510 missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120531697 missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120528639 splice site probably benign
IGL03308:Zfp106 APN 2 120524024 missense probably benign 0.00
IGL03324:Zfp106 APN 2 120535387 missense probably benign 0.01
lepton UTSW 2 120532104 missense probably damaging 0.98
Proton UTSW 2 120510534 missense probably damaging 1.00
quark UTSW 2 120535060 nonsense probably null
R0040_zfp106_031 UTSW 2 120531613 missense probably damaging 1.00
string UTSW 2 120533594 missense probably damaging 0.96
theory UTSW 2 120533677 nonsense probably null
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120520487 missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120533875 missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120528472 splice site probably null
R0558:Zfp106 UTSW 2 120532196 missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120527016 missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120555248 missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120535603 missense probably benign 0.00
R1124:Zfp106 UTSW 2 120534714 missense probably benign 0.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120524079 missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120533594 missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120533677 nonsense probably null
R1754:Zfp106 UTSW 2 120533763 missense probably damaging 0.96
R1754:Zfp106 UTSW 2 120533764 missense probably damaging 0.98
R1755:Zfp106 UTSW 2 120535175 missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120520428 missense probably benign 0.03
R1875:Zfp106 UTSW 2 120513615 critical splice donor site probably null
R1903:Zfp106 UTSW 2 120526848 missense probably benign 0.02
R1932:Zfp106 UTSW 2 120531681 missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120523529 missense probably benign 0.11
R2301:Zfp106 UTSW 2 120535650 missense probably benign 0.04
R3429:Zfp106 UTSW 2 120527063 missense probably benign 0.00
R3720:Zfp106 UTSW 2 120534599 missense probably benign 0.01
R3875:Zfp106 UTSW 2 120534613 missense probably benign 0.08
R3881:Zfp106 UTSW 2 120532149 missense probably benign 0.01
R3921:Zfp106 UTSW 2 120533616 missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120534856 missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120526899 splice site probably null
R4678:Zfp106 UTSW 2 120533740 missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120533919 missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120534727 missense probably benign 0.01
R5227:Zfp106 UTSW 2 120523968 missense probably benign 0.11
R5328:Zfp106 UTSW 2 120520417 missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120534781 missense probably benign 0.02
R5624:Zfp106 UTSW 2 120531957 missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120533507 splice site probably null
R5691:Zfp106 UTSW 2 120524471 missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120516006 missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6298:Zfp106 UTSW 2 120522704 missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120532104 missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120534502 missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120535060 nonsense probably null
R6765:Zfp106 UTSW 2 120539454 missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120531632 missense probably damaging 0.99
R7453:Zfp106 UTSW 2 120510527 missense probably damaging 1.00
R7453:Zfp106 UTSW 2 120545919 splice site probably null
R7643:Zfp106 UTSW 2 120512734 missense probably benign 0.01
R7829:Zfp106 UTSW 2 120524057 missense possibly damaging 0.94
R7897:Zfp106 UTSW 2 120535615 nonsense probably null
R7909:Zfp106 UTSW 2 120514219 missense probably damaging 1.00
R8054:Zfp106 UTSW 2 120524519 missense possibly damaging 0.93
R8124:Zfp106 UTSW 2 120524331 missense probably benign 0.44
R8203:Zfp106 UTSW 2 120519078 missense probably damaging 1.00
R8350:Zfp106 UTSW 2 120535618 missense
R8450:Zfp106 UTSW 2 120535618 missense
R8698:Zfp106 UTSW 2 120524119 critical splice donor site probably null
RF008:Zfp106 UTSW 2 120524545 small deletion probably benign
RF025:Zfp106 UTSW 2 120524545 small deletion probably benign
X0025:Zfp106 UTSW 2 120534816 missense probably benign
Z1088:Zfp106 UTSW 2 120530490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAATTACTGCTGGGAGACCAC -3'
(R):5'- CATAATGCCTGTCATGCATTCAGCC -3'

Sequencing Primer
(F):5'- AGAGATGACTTCACACTTTCCTGG -3'
(R):5'- TGCATTCAGCCCGAGAC -3'
Posted On2014-07-17