Incidental Mutation 'R0040:Phrf1'
ID216036
Institutional Source Beutler Lab
Gene Symbol Phrf1
Ensembl Gene ENSMUSG00000038611
Gene NamePHD and ring finger domains 1
Synonyms
MMRRC Submission 038334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0040 (G1)
Quality Score79
Status Validated
Chromosome7
Chromosomal Location141228784-141262750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 141243857 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 196 (R196L)
Ref Sequence ENSEMBL: ENSMUSP00000120759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000155123]
Predicted Effect unknown
Transcript: ENSMUST00000106027
AA Change: R196L
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611
AA Change: R196L

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000122143
AA Change: R37L
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611
AA Change: R37L

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134057
SMART Domains Protein: ENSMUSP00000118425
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
RING 27 67 3.78e-5 SMART
C1 91 147 7.05e-2 SMART
PHD 105 151 1.77e-14 SMART
RING 106 150 3.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155123
AA Change: R196L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611
AA Change: R196L

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Meta Mutation Damage Score 0.2391 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,283,024 probably benign Het
Antxr2 G A 5: 97,938,425 T441I possibly damaging Het
Apcs A G 1: 172,894,456 Y108H probably benign Het
Atad5 A G 11: 80,098,014 T666A probably benign Het
Atcay C T 10: 81,210,519 probably null Het
Bahcc1 A G 11: 120,268,370 D141G probably damaging Het
Ceacam10 A G 7: 24,778,264 Y68C probably damaging Het
Cfap54 T A 10: 92,977,039 Q1344L probably benign Het
Cyb5r4 A G 9: 87,066,742 probably null Het
Cyp2b9 G T 7: 26,173,474 S14I possibly damaging Het
Dusp12 A G 1: 170,880,657 Y164H probably damaging Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fbxl13 T C 5: 21,486,373 T671A probably damaging Het
Fbxo28 G T 1: 182,326,240 probably benign Het
Fbxo44 A G 4: 148,158,695 L89P probably damaging Het
Fndc3b T A 3: 27,556,117 probably null Het
Gm884 G A 11: 103,542,990 P942S probably damaging Het
Gm9955 G T 18: 24,709,152 probably benign Het
Gprc6a T A 10: 51,614,984 K819* probably null Het
Gxylt1 A T 15: 93,254,555 probably benign Het
Hspa12a T C 19: 58,799,624 T589A probably benign Het
Idh2 A G 7: 80,097,822 S317P probably damaging Het
Ifi30 T C 8: 70,763,776 probably null Het
Ifna16 G A 4: 88,676,630 A76V probably benign Het
Itpr2 C T 6: 146,345,140 E1127K probably damaging Het
Kank4 A G 4: 98,779,220 V330A probably benign Het
Kpna1 T A 16: 36,023,241 D328E probably damaging Het
Krt71 T A 15: 101,738,433 H280L possibly damaging Het
Mapt A G 11: 104,305,398 M446V probably damaging Het
Med1 C T 11: 98,166,255 probably null Het
Mif T A 10: 75,859,780 H63L probably damaging Het
Mycbp2 A G 14: 103,224,272 V1447A probably benign Het
Myo1b A T 1: 51,781,989 I451N probably damaging Het
Nme2 A T 11: 93,951,930 probably null Het
Nubp1 A G 16: 10,421,117 T199A probably damaging Het
Nup210l T A 3: 90,181,905 V1165D probably damaging Het
Nup98 T A 7: 102,192,034 T122S probably damaging Het
Olfr1106 C T 2: 87,049,204 E11K probably damaging Het
Olfr304 A T 7: 86,386,507 L51Q probably benign Het
Olfr354 T C 2: 36,907,458 F171L probably damaging Het
Olfr771 T A 10: 129,160,739 I82L probably benign Het
Pard3b A T 1: 62,637,820 Y1170F probably damaging Het
Pear1 T C 3: 87,754,358 D536G probably damaging Het
Plxna2 G T 1: 194,643,896 R46L probably benign Het
Rbm39 G A 2: 156,148,179 T496I possibly damaging Het
Rpl14 C G 9: 120,572,101 F3L possibly damaging Het
Rtf2 G A 2: 172,444,696 S40N probably damaging Het
Runx2 G A 17: 44,608,254 S481L possibly damaging Het
Sh3rf1 T A 8: 61,329,252 Y143N possibly damaging Het
Siglec15 G A 18: 78,048,877 probably benign Het
Slc4a8 T A 15: 100,789,846 I288N probably damaging Het
Ttc38 C A 15: 85,841,489 F184L probably damaging Het
Vmn1r28 T C 6: 58,265,894 Y241H probably damaging Het
Vmn2r110 A T 17: 20,596,084 V59D probably benign Het
Wdpcp A G 11: 21,711,638 I303M probably damaging Het
Zc3h12d G A 10: 7,867,914 A483T probably benign Het
Zfp106 C A 2: 120,531,613 K1008N probably damaging Het
Zfp334 A G 2: 165,381,572 Y184H probably benign Het
Zfp68 G A 5: 138,607,779 T94I probably benign Het
Zkscan3 A T 13: 21,394,920 probably null Het
Other mutations in Phrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Phrf1 APN 7 141258877 unclassified probably benign
IGL01391:Phrf1 APN 7 141262481 missense probably damaging 1.00
IGL01472:Phrf1 APN 7 141256490 splice site probably benign
IGL01633:Phrf1 APN 7 141260500 missense probably benign 0.43
IGL01808:Phrf1 APN 7 141260966 missense probably damaging 1.00
IGL02004:Phrf1 APN 7 141260333 missense probably benign 0.39
IGL02138:Phrf1 APN 7 141259283 unclassified probably benign
IGL02678:Phrf1 APN 7 141260282 missense probably damaging 1.00
IGL03077:Phrf1 APN 7 141254968 nonsense probably null
PIT4466001:Phrf1 UTSW 7 141258812 missense unknown
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0036:Phrf1 UTSW 7 141261780 missense probably damaging 1.00
R0358:Phrf1 UTSW 7 141258304 unclassified probably benign
R0445:Phrf1 UTSW 7 141247331 utr 3 prime probably benign
R0535:Phrf1 UTSW 7 141260065 missense probably benign 0.07
R0561:Phrf1 UTSW 7 141254963 missense probably benign 0.00
R0940:Phrf1 UTSW 7 141254855 splice site probably benign
R1499:Phrf1 UTSW 7 141256651 missense probably damaging 1.00
R1511:Phrf1 UTSW 7 141259801 unclassified probably benign
R1651:Phrf1 UTSW 7 141237521 missense probably benign
R1691:Phrf1 UTSW 7 141261874 nonsense probably null
R1778:Phrf1 UTSW 7 141232456 missense probably benign 0.01
R1851:Phrf1 UTSW 7 141240918 missense probably damaging 1.00
R2239:Phrf1 UTSW 7 141237692 missense probably damaging 1.00
R2857:Phrf1 UTSW 7 141259680 unclassified probably benign
R3796:Phrf1 UTSW 7 141259918 nonsense probably null
R3797:Phrf1 UTSW 7 141259918 nonsense probably null
R3798:Phrf1 UTSW 7 141259918 nonsense probably null
R3799:Phrf1 UTSW 7 141259918 nonsense probably null
R4080:Phrf1 UTSW 7 141259720 unclassified probably benign
R4081:Phrf1 UTSW 7 141259057 unclassified probably benign
R4557:Phrf1 UTSW 7 141258929 unclassified probably benign
R5217:Phrf1 UTSW 7 141260703 missense probably damaging 1.00
R5218:Phrf1 UTSW 7 141261301 missense possibly damaging 0.94
R5276:Phrf1 UTSW 7 141259283 unclassified probably benign
R5442:Phrf1 UTSW 7 141240937 missense probably damaging 1.00
R5501:Phrf1 UTSW 7 141259921 missense possibly damaging 0.91
R5695:Phrf1 UTSW 7 141258465 unclassified probably benign
R5837:Phrf1 UTSW 7 141260061 missense probably benign 0.34
R5907:Phrf1 UTSW 7 141260540 missense possibly damaging 0.79
R5996:Phrf1 UTSW 7 141259102 unclassified probably benign
R6024:Phrf1 UTSW 7 141258985 unclassified probably benign
R6244:Phrf1 UTSW 7 141237673 missense probably damaging 1.00
R6512:Phrf1 UTSW 7 141260396 missense possibly damaging 0.88
R7016:Phrf1 UTSW 7 141237563 missense probably damaging 0.98
R7311:Phrf1 UTSW 7 141240933 missense unknown
R7409:Phrf1 UTSW 7 141259292 missense unknown
R7517:Phrf1 UTSW 7 141256610 missense unknown
R7560:Phrf1 UTSW 7 141231225 critical splice acceptor site probably null
R7699:Phrf1 UTSW 7 141254929 missense unknown
R7700:Phrf1 UTSW 7 141254929 missense unknown
R7867:Phrf1 UTSW 7 141256611 missense unknown
R7895:Phrf1 UTSW 7 141259375 missense unknown
R8179:Phrf1 UTSW 7 141256580 missense unknown
R8705:Phrf1 UTSW 7 141258738 missense unknown
R8708:Phrf1 UTSW 7 141232533 missense unknown
R8748:Phrf1 UTSW 7 141258235 missense unknown
R8768:Phrf1 UTSW 7 141258738 missense unknown
R8789:Phrf1 UTSW 7 141256668 missense unknown
R8859:Phrf1 UTSW 7 141256603 missense unknown
X0027:Phrf1 UTSW 7 141256568 missense probably benign
Z1176:Phrf1 UTSW 7 141243883 missense unknown
Z1176:Phrf1 UTSW 7 141258818 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCAAGTAGATCTTAGGCCAGTGG -3'
(R):5'- GATGATGCTGTCCCAAAAGCAACC -3'

Sequencing Primer
(F):5'- TTGACCACTCAGATGTTGAGGG -3'
(R):5'- ATATACTGACGGCCTTTGAGCAG -3'
Posted On2014-07-17