Incidental Mutation 'R0040:Slc4a8'
ID216043
Institutional Source Beutler Lab
Gene Symbol Slc4a8
Ensembl Gene ENSMUSG00000023032
Gene Namesolute carrier family 4 (anion exchanger), member 8
SynonymsNDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3
MMRRC Submission 038334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R0040 (G1)
Quality Score27
Status Validated
Chromosome15
Chromosomal Location100761747-100823968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100789846 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 288 (I288N)
Ref Sequence ENSEMBL: ENSMUSP00000125090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023776] [ENSMUST00000162049]
Predicted Effect probably damaging
Transcript: ENSMUST00000023776
AA Change: I340N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023776
Gene: ENSMUSG00000023032
AA Change: I340N

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Pfam:Band_3_cyto 145 402 1.4e-105 PFAM
Pfam:HCO3_cotransp 443 956 9.6e-247 PFAM
transmembrane domain 964 986 N/A INTRINSIC
low complexity region 1010 1027 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162049
AA Change: I288N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125090
Gene: ENSMUSG00000023032
AA Change: I288N

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
Pfam:Band_3_cyto 93 350 6.5e-103 PFAM
Pfam:HCO3_cotransp 390 904 1.6e-251 PFAM
transmembrane domain 912 934 N/A INTRINSIC
low complexity region 958 975 N/A INTRINSIC
Meta Mutation Damage Score 0.5979 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that functions to transport sodium and bicarbonate ions across the cell membrane. The encoded protein is important for pH regulation in neurons. The activity of this protein can be inhibited by 4,4'-Di-isothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal sodium and chloride ion excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr G A 13: 74,283,024 probably benign Het
Antxr2 G A 5: 97,938,425 T441I possibly damaging Het
Apcs A G 1: 172,894,456 Y108H probably benign Het
Atad5 A G 11: 80,098,014 T666A probably benign Het
Atcay C T 10: 81,210,519 probably null Het
Bahcc1 A G 11: 120,268,370 D141G probably damaging Het
Ceacam10 A G 7: 24,778,264 Y68C probably damaging Het
Cfap54 T A 10: 92,977,039 Q1344L probably benign Het
Cyb5r4 A G 9: 87,066,742 probably null Het
Cyp2b9 G T 7: 26,173,474 S14I possibly damaging Het
Dusp12 A G 1: 170,880,657 Y164H probably damaging Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fbxl13 T C 5: 21,486,373 T671A probably damaging Het
Fbxo28 G T 1: 182,326,240 probably benign Het
Fbxo44 A G 4: 148,158,695 L89P probably damaging Het
Fndc3b T A 3: 27,556,117 probably null Het
Gm884 G A 11: 103,542,990 P942S probably damaging Het
Gm9955 G T 18: 24,709,152 probably benign Het
Gprc6a T A 10: 51,614,984 K819* probably null Het
Gxylt1 A T 15: 93,254,555 probably benign Het
Hspa12a T C 19: 58,799,624 T589A probably benign Het
Idh2 A G 7: 80,097,822 S317P probably damaging Het
Ifi30 T C 8: 70,763,776 probably null Het
Ifna16 G A 4: 88,676,630 A76V probably benign Het
Itpr2 C T 6: 146,345,140 E1127K probably damaging Het
Kank4 A G 4: 98,779,220 V330A probably benign Het
Kpna1 T A 16: 36,023,241 D328E probably damaging Het
Krt71 T A 15: 101,738,433 H280L possibly damaging Het
Mapt A G 11: 104,305,398 M446V probably damaging Het
Med1 C T 11: 98,166,255 probably null Het
Mif T A 10: 75,859,780 H63L probably damaging Het
Mycbp2 A G 14: 103,224,272 V1447A probably benign Het
Myo1b A T 1: 51,781,989 I451N probably damaging Het
Nme2 A T 11: 93,951,930 probably null Het
Nubp1 A G 16: 10,421,117 T199A probably damaging Het
Nup210l T A 3: 90,181,905 V1165D probably damaging Het
Nup98 T A 7: 102,192,034 T122S probably damaging Het
Olfr1106 C T 2: 87,049,204 E11K probably damaging Het
Olfr304 A T 7: 86,386,507 L51Q probably benign Het
Olfr354 T C 2: 36,907,458 F171L probably damaging Het
Olfr771 T A 10: 129,160,739 I82L probably benign Het
Pard3b A T 1: 62,637,820 Y1170F probably damaging Het
Pear1 T C 3: 87,754,358 D536G probably damaging Het
Phrf1 G T 7: 141,243,857 R196L probably damaging Het
Plxna2 G T 1: 194,643,896 R46L probably benign Het
Rbm39 G A 2: 156,148,179 T496I possibly damaging Het
Rpl14 C G 9: 120,572,101 F3L possibly damaging Het
Rtf2 G A 2: 172,444,696 S40N probably damaging Het
Runx2 G A 17: 44,608,254 S481L possibly damaging Het
Sh3rf1 T A 8: 61,329,252 Y143N possibly damaging Het
Siglec15 G A 18: 78,048,877 probably benign Het
Ttc38 C A 15: 85,841,489 F184L probably damaging Het
Vmn1r28 T C 6: 58,265,894 Y241H probably damaging Het
Vmn2r110 A T 17: 20,596,084 V59D probably benign Het
Wdpcp A G 11: 21,711,638 I303M probably damaging Het
Zc3h12d G A 10: 7,867,914 A483T probably benign Het
Zfp106 C A 2: 120,531,613 K1008N probably damaging Het
Zfp334 A G 2: 165,381,572 Y184H probably benign Het
Zfp68 G A 5: 138,607,779 T94I probably benign Het
Zkscan3 A T 13: 21,394,920 probably null Het
Other mutations in Slc4a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Slc4a8 APN 15 100807438 missense possibly damaging 0.50
IGL01633:Slc4a8 APN 15 100787247 missense probably damaging 1.00
IGL02945:Slc4a8 APN 15 100807199 critical splice acceptor site probably null
IGL03172:Slc4a8 APN 15 100799717 missense probably benign
R0008:Slc4a8 UTSW 15 100800493 missense possibly damaging 0.67
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0257:Slc4a8 UTSW 15 100784880 splice site probably benign
R0393:Slc4a8 UTSW 15 100774638 missense probably damaging 0.99
R0508:Slc4a8 UTSW 15 100789092 missense probably benign 0.01
R0639:Slc4a8 UTSW 15 100796550 missense probably damaging 1.00
R1640:Slc4a8 UTSW 15 100783787 missense probably benign 0.13
R1692:Slc4a8 UTSW 15 100800573 missense probably damaging 1.00
R1766:Slc4a8 UTSW 15 100787212 missense probably benign 0.00
R1955:Slc4a8 UTSW 15 100807376 missense probably damaging 1.00
R2157:Slc4a8 UTSW 15 100806373 missense probably damaging 1.00
R2206:Slc4a8 UTSW 15 100807445 missense probably damaging 1.00
R2229:Slc4a8 UTSW 15 100809299 missense probably damaging 1.00
R2274:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R2275:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R4299:Slc4a8 UTSW 15 100796640 critical splice donor site probably null
R4482:Slc4a8 UTSW 15 100810599 missense probably damaging 1.00
R5038:Slc4a8 UTSW 15 100795821 missense probably damaging 0.98
R5586:Slc4a8 UTSW 15 100787164 missense probably damaging 1.00
R5594:Slc4a8 UTSW 15 100795887 missense probably damaging 1.00
R5804:Slc4a8 UTSW 15 100791625 missense possibly damaging 0.71
R5815:Slc4a8 UTSW 15 100788211 missense probably benign 0.42
R5921:Slc4a8 UTSW 15 100814447 splice site probably benign
R6029:Slc4a8 UTSW 15 100807339 missense probably benign 0.00
R6212:Slc4a8 UTSW 15 100811571 missense possibly damaging 0.69
R6321:Slc4a8 UTSW 15 100789164 missense probably damaging 0.99
R6574:Slc4a8 UTSW 15 100807316 missense probably damaging 1.00
R6829:Slc4a8 UTSW 15 100800538 missense probably damaging 1.00
R7023:Slc4a8 UTSW 15 100791643 missense probably benign 0.00
R7082:Slc4a8 UTSW 15 100791027 missense probably damaging 1.00
R7197:Slc4a8 UTSW 15 100790976 missense probably damaging 1.00
R7352:Slc4a8 UTSW 15 100790984 missense probably damaging 1.00
R7391:Slc4a8 UTSW 15 100784862 missense probably damaging 0.98
R7627:Slc4a8 UTSW 15 100788223 missense probably benign 0.08
R7810:Slc4a8 UTSW 15 100798178 missense possibly damaging 0.72
R8026:Slc4a8 UTSW 15 100787289 missense possibly damaging 0.72
Z1088:Slc4a8 UTSW 15 100761951 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGCCGTGTTTTGAAAAGACATCC -3'
(R):5'- TCAGAAACGGTCCTTGAACTGCTC -3'

Sequencing Primer
(F):5'- CCTTCCGGTAGCTAGAAATCGTG -3'
(R):5'- TTGAACTGCTCCCAGCAGAC -3'
Posted On2014-07-17