Incidental Mutation 'R0130:Cd22'
ID 21606
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene Name CD22 antigen
Synonyms Lyb8, Lyb-8
MMRRC Submission 038415-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0130 (G1)
Quality Score 222
Status Validated (trace)
Chromosome 7
Chromosomal Location 30564829-30579767 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30569389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 402 (Y402H)
Ref Sequence ENSEMBL: ENSMUSP00000150025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000214289] [ENSMUST00000190646]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000019248
AA Change: Y576H

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: Y576H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108125
AA Change: Y576H

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: Y576H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186154
AA Change: Y576H

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: Y576H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect possibly damaging
Transcript: ENSMUST00000189718
AA Change: Y576H

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: Y576H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect possibly damaging
Transcript: ENSMUST00000190617
AA Change: Y576H

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: Y576H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214289
AA Change: Y402H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000190646
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,994,094 (GRCm39) Y37F probably damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Apol7c A G 15: 77,410,562 (GRCm39) I128T possibly damaging Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Arfip2 A G 7: 105,288,205 (GRCm39) probably benign Het
Atp5mf A T 5: 145,124,992 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
Cd248 A G 19: 5,119,990 (GRCm39) T613A probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Cenpc1 A T 5: 86,194,405 (GRCm39) D120E probably benign Het
Chd3 T A 11: 69,250,656 (GRCm39) H691L probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
Ctnnd2 A T 15: 30,922,059 (GRCm39) E895V probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,585,108 (GRCm39) T837K probably benign Het
Eif2ak3 C A 6: 70,858,716 (GRCm39) probably benign Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Fat2 T A 11: 55,142,944 (GRCm39) M4302L probably benign Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Gde1 A T 7: 118,294,283 (GRCm39) F63L probably benign Het
Gjc3 A G 5: 137,956,202 (GRCm39) S28P probably benign Het
Gm10250 G A 15: 5,150,473 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k11 T C 19: 5,740,843 (GRCm39) L190P probably damaging Het
Mki67 T A 7: 135,298,188 (GRCm39) Q2282L probably damaging Het
Mthfd2 T A 6: 83,285,990 (GRCm39) I272F probably damaging Het
Myom1 A T 17: 71,352,750 (GRCm39) D358V probably damaging Het
Nebl T C 2: 17,395,737 (GRCm39) probably benign Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Nlrp2 T A 7: 5,325,417 (GRCm39) N14Y possibly damaging Het
Or14a258 T C 7: 86,035,514 (GRCm39) Y118C probably damaging Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pld2 T G 11: 70,445,174 (GRCm39) N591K probably benign Het
Plekha7 A G 7: 115,769,939 (GRCm39) M276T probably damaging Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Prtg A G 9: 72,716,998 (GRCm39) Y113C probably damaging Het
Rab38 T A 7: 88,099,749 (GRCm39) I88N probably damaging Het
Rbfox2 A G 15: 76,976,057 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sec14l1 A T 11: 117,047,233 (GRCm39) K637I possibly damaging Het
Sh2b1 A T 7: 126,070,620 (GRCm39) D360E possibly damaging Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Tectb G T 19: 55,170,393 (GRCm39) K81N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Tiam1 T C 16: 89,694,642 (GRCm39) M272V probably benign Het
Trav13-3 T A 14: 53,967,233 (GRCm39) noncoding transcript Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30,575,572 (GRCm39) missense probably benign 0.01
IGL02236:Cd22 APN 7 30,566,893 (GRCm39) missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30,569,308 (GRCm39) missense probably damaging 1.00
IGL02335:Cd22 APN 7 30,575,559 (GRCm39) missense probably damaging 1.00
IGL02397:Cd22 APN 7 30,577,050 (GRCm39) missense probably benign
IGL02402:Cd22 APN 7 30,576,955 (GRCm39) missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30,576,985 (GRCm39) missense probably benign 0.40
IGL02736:Cd22 APN 7 30,577,470 (GRCm39) splice site probably null
blitz UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
crullers UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
gansu UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
lacrima UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
Lluvia UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
Mist UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
rain UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
well UTSW 7 30,577,212 (GRCm39) nonsense probably null
Yosemite UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
FR4304:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30,577,507 (GRCm39) missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30,577,224 (GRCm39) missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30,566,533 (GRCm39) splice site probably benign
R0926:Cd22 UTSW 7 30,568,934 (GRCm39) critical splice donor site probably null
R1245:Cd22 UTSW 7 30,569,308 (GRCm39) missense probably damaging 1.00
R1332:Cd22 UTSW 7 30,569,912 (GRCm39) missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30,572,595 (GRCm39) missense probably benign 0.07
R1716:Cd22 UTSW 7 30,577,103 (GRCm39) missense probably damaging 1.00
R1980:Cd22 UTSW 7 30,572,658 (GRCm39) missense probably damaging 1.00
R2017:Cd22 UTSW 7 30,572,205 (GRCm39) missense probably damaging 0.99
R2061:Cd22 UTSW 7 30,575,581 (GRCm39) missense probably benign 0.03
R2061:Cd22 UTSW 7 30,569,530 (GRCm39) missense probably damaging 1.00
R2075:Cd22 UTSW 7 30,569,123 (GRCm39) missense probably damaging 1.00
R2216:Cd22 UTSW 7 30,566,471 (GRCm39) missense probably damaging 1.00
R3886:Cd22 UTSW 7 30,569,532 (GRCm39) missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30,575,325 (GRCm39) missense probably damaging 0.98
R4701:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R4796:Cd22 UTSW 7 30,572,381 (GRCm39) splice site probably null
R5179:Cd22 UTSW 7 30,575,299 (GRCm39) missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30,576,959 (GRCm39) missense probably damaging 1.00
R5456:Cd22 UTSW 7 30,575,464 (GRCm39) missense probably benign 0.02
R5511:Cd22 UTSW 7 30,569,496 (GRCm39) missense probably damaging 1.00
R5513:Cd22 UTSW 7 30,566,450 (GRCm39) missense probably damaging 0.99
R5611:Cd22 UTSW 7 30,577,575 (GRCm39) unclassified probably benign
R5656:Cd22 UTSW 7 30,569,198 (GRCm39) missense probably damaging 1.00
R5966:Cd22 UTSW 7 30,566,083 (GRCm39) missense probably damaging 1.00
R6329:Cd22 UTSW 7 30,577,193 (GRCm39) missense probably damaging 0.99
R6356:Cd22 UTSW 7 30,577,127 (GRCm39) missense probably damaging 1.00
R6455:Cd22 UTSW 7 30,575,578 (GRCm39) missense probably damaging 1.00
R6550:Cd22 UTSW 7 30,576,977 (GRCm39) missense probably benign 0.00
R6656:Cd22 UTSW 7 30,577,182 (GRCm39) missense probably benign 0.11
R6688:Cd22 UTSW 7 30,572,389 (GRCm39) missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30,572,856 (GRCm39) splice site probably null
R6957:Cd22 UTSW 7 30,566,999 (GRCm39) missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30,577,504 (GRCm39) missense probably benign 0.03
R7083:Cd22 UTSW 7 30,567,473 (GRCm39) missense probably damaging 0.99
R7225:Cd22 UTSW 7 30,577,059 (GRCm39) missense not run
R7732:Cd22 UTSW 7 30,569,482 (GRCm39) missense probably damaging 1.00
R8686:Cd22 UTSW 7 30,569,494 (GRCm39) missense probably benign 0.03
R8851:Cd22 UTSW 7 30,577,084 (GRCm39) missense probably benign 0.01
R8987:Cd22 UTSW 7 30,577,172 (GRCm39) missense probably damaging 1.00
R9051:Cd22 UTSW 7 30,575,449 (GRCm39) missense probably benign
R9098:Cd22 UTSW 7 30,567,391 (GRCm39) missense probably benign 0.00
R9124:Cd22 UTSW 7 30,572,662 (GRCm39) missense probably benign 0.01
R9167:Cd22 UTSW 7 30,575,430 (GRCm39) missense probably benign 0.07
R9319:Cd22 UTSW 7 30,569,329 (GRCm39) missense probably damaging 1.00
R9369:Cd22 UTSW 7 30,576,999 (GRCm39) missense probably benign 0.09
X0025:Cd22 UTSW 7 30,572,844 (GRCm39) splice site probably null
Z1176:Cd22 UTSW 7 30,568,955 (GRCm39) missense probably damaging 1.00
Z1176:Cd22 UTSW 7 30,567,388 (GRCm39) missense probably benign 0.03
Z1186:Cd22 UTSW 7 30,566,891 (GRCm39) missense probably benign
Z1186:Cd22 UTSW 7 30,566,478 (GRCm39) missense probably benign 0.01
Z1186:Cd22 UTSW 7 30,575,292 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCATCTGTAAAGGAGACCCCGAG -3'
(R):5'- CCTGTCATCCTGAATGTCCACTGTG -3'

Sequencing Primer
(F):5'- TAAAGGAGACCCCGAGTCAGG -3'
(R):5'- AACATCACCTGAGGCTGTG -3'
Posted On 2013-04-11