Incidental Mutation 'R0057:Msh4'
ID 216067
Institutional Source Beutler Lab
Gene Symbol Msh4
Ensembl Gene ENSMUSG00000005493
Gene Name mutS homolog 4
Synonyms mMsh4, 4930485C04Rik
MMRRC Submission 038351-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.477) question?
Stock # R0057 (G1)
Quality Score 28
Status Validated
Chromosome 3
Chromosomal Location 153857149-153906138 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 153869681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 686 (A686T)
Ref Sequence ENSEMBL: ENSMUSP00000005630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]
AlphaFold Q99MT2
Predicted Effect probably benign
Transcript: ENSMUST00000005630
AA Change: A686T

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: A686T

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186220
Predicted Effect probably benign
Transcript: ENSMUST00000188338
AA Change: A598T

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: A598T

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189189
Predicted Effect probably benign
Transcript: ENSMUST00000190449
AA Change: A492T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: A492T

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191606
Meta Mutation Damage Score 0.1241 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,570,919 H693Q probably damaging Het
Ap5z1 T C 5: 142,470,389 probably benign Het
Bloc1s6 T A 2: 122,744,221 probably benign Het
Caskin1 A G 17: 24,504,896 N886S probably damaging Het
Ctse G T 1: 131,663,371 D97Y probably damaging Het
Dcaf11 T C 14: 55,569,310 V490A probably benign Het
Dctn1 A G 6: 83,179,892 H7R probably benign Het
Dscam A C 16: 96,673,736 W1209G probably damaging Het
Fuk C T 8: 110,893,768 probably benign Het
Gna11 A G 10: 81,530,940 M312T probably benign Het
Hacd2 T A 16: 35,075,627 V105D probably damaging Het
Htra4 C A 8: 25,038,808 V23L probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nbas T A 12: 13,390,957 M1096K probably benign Het
Olfr1022 C A 2: 85,869,253 Y220* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prlr A G 15: 10,328,423 Y328C probably damaging Het
Ros1 C T 10: 52,180,191 V68I probably benign Het
Shmt2 G A 10: 127,521,048 T31M possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tas2r135 A G 6: 42,406,420 T298A probably benign Het
Tmem175 C T 5: 108,639,562 H92Y probably damaging Het
Top3a C T 11: 60,740,684 A951T probably benign Het
Trpc4ap T C 2: 155,640,486 E528G possibly damaging Het
Trpm6 T C 19: 18,786,755 C242R probably benign Het
Vwa7 G A 17: 35,024,547 S710N possibly damaging Het
Zfa-ps A T 10: 52,545,106 noncoding transcript Het
Zfp770 T A 2: 114,197,232 R119* probably null Het
Other mutations in Msh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Msh4 APN 3 153883735 missense possibly damaging 0.88
IGL01098:Msh4 APN 3 153877982 splice site probably benign
IGL01609:Msh4 APN 3 153897397 missense probably damaging 1.00
IGL01785:Msh4 APN 3 153857507 missense probably damaging 1.00
IGL01939:Msh4 APN 3 153857589 missense probably damaging 1.00
IGL02022:Msh4 APN 3 153886956 missense probably damaging 1.00
IGL02209:Msh4 APN 3 153888862 missense probably damaging 1.00
IGL02224:Msh4 APN 3 153890185 missense possibly damaging 0.94
IGL02240:Msh4 APN 3 153873674 missense probably damaging 0.98
IGL02493:Msh4 APN 3 153877908 critical splice donor site probably null
IGL02576:Msh4 APN 3 153867746 missense probably damaging 1.00
IGL02616:Msh4 APN 3 153857523 missense probably benign
IGL02812:Msh4 APN 3 153901400 splice site probably benign
IGL02888:Msh4 APN 3 153896913 nonsense probably null
IGL02992:Msh4 APN 3 153872325 missense possibly damaging 0.79
IGL03191:Msh4 APN 3 153869608 missense probably damaging 0.97
P0021:Msh4 UTSW 3 153888818 missense probably damaging 1.00
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0368:Msh4 UTSW 3 153888825 missense probably damaging 1.00
R0377:Msh4 UTSW 3 153896890 missense probably benign 0.00
R0631:Msh4 UTSW 3 153866420 missense probably benign 0.02
R0632:Msh4 UTSW 3 153896895 missense probably damaging 1.00
R0677:Msh4 UTSW 3 153879367 missense possibly damaging 0.69
R0909:Msh4 UTSW 3 153863504 missense probably benign 0.00
R1081:Msh4 UTSW 3 153872358 missense probably benign 0.06
R1463:Msh4 UTSW 3 153857570 missense probably damaging 1.00
R1476:Msh4 UTSW 3 153863384 missense probably damaging 1.00
R1669:Msh4 UTSW 3 153876720 missense possibly damaging 0.47
R1733:Msh4 UTSW 3 153867767 missense probably damaging 1.00
R1859:Msh4 UTSW 3 153905880 missense probably benign
R2168:Msh4 UTSW 3 153867835 nonsense probably null
R2378:Msh4 UTSW 3 153863477 missense probably damaging 0.99
R2991:Msh4 UTSW 3 153905860 missense probably benign
R3025:Msh4 UTSW 3 153863491 missense probably damaging 1.00
R4604:Msh4 UTSW 3 153872283 missense probably damaging 1.00
R4757:Msh4 UTSW 3 153879387 missense probably damaging 0.99
R5205:Msh4 UTSW 3 153866412 missense probably damaging 1.00
R5285:Msh4 UTSW 3 153873713 missense probably benign 0.03
R5766:Msh4 UTSW 3 153867840 missense probably damaging 1.00
R5777:Msh4 UTSW 3 153863439 missense probably benign 0.01
R5888:Msh4 UTSW 3 153867723 critical splice donor site probably null
R7384:Msh4 UTSW 3 153888748 missense probably benign 0.23
R7408:Msh4 UTSW 3 153876745 missense probably benign 0.06
R7487:Msh4 UTSW 3 153863510 missense probably damaging 1.00
R7503:Msh4 UTSW 3 153867750 missense probably damaging 1.00
R7726:Msh4 UTSW 3 153866320 critical splice donor site probably null
R7990:Msh4 UTSW 3 153896892 missense probably damaging 1.00
R8097:Msh4 UTSW 3 153877908 critical splice donor site probably null
R8805:Msh4 UTSW 3 153857633 missense probably benign 0.00
R8814:Msh4 UTSW 3 153872320 missense probably damaging 1.00
R8861:Msh4 UTSW 3 153901468 missense probably benign 0.04
R8970:Msh4 UTSW 3 153869732 nonsense probably null
R9010:Msh4 UTSW 3 153890182 missense probably benign 0.30
R9338:Msh4 UTSW 3 153867807 missense possibly damaging 0.55
R9598:Msh4 UTSW 3 153901511 missense possibly damaging 0.93
R9780:Msh4 UTSW 3 153876705 missense probably damaging 1.00
Z1177:Msh4 UTSW 3 153879368 missense probably benign 0.00
Z1177:Msh4 UTSW 3 153901443 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCGAGTGGTTCTTGTTCAAACCTCC -3'
(R):5'- AGCTGTGAAGCAGTGTGTAGGC -3'

Sequencing Primer
(F):5'- TTGTTCAAACCTCCACAACTGG -3'
(R):5'- AGGTAAGCCCTTTATCTAGAGGAGTC -3'
Posted On 2014-07-21