Incidental Mutation 'R0057:Tas2r135'
ID216069
Institutional Source Beutler Lab
Gene Symbol Tas2r135
Ensembl Gene ENSMUSG00000056203
Gene Nametaste receptor, type 2, member 135
Synonymsmt2r38, Tas2r35
MMRRC Submission 038351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0057 (G1)
Quality Score59
Status Validated
Chromosome6
Chromosomal Location42405434-42406526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42406420 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 298 (T298A)
Ref Sequence ENSEMBL: ENSMUSP00000070247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000070178
AA Change: T298A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203
AA Change: T298A

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,570,919 H693Q probably damaging Het
Ap5z1 T C 5: 142,470,389 probably benign Het
Bloc1s6 T A 2: 122,744,221 probably benign Het
Caskin1 A G 17: 24,504,896 N886S probably damaging Het
Ctse G T 1: 131,663,371 D97Y probably damaging Het
Dcaf11 T C 14: 55,569,310 V490A probably benign Het
Dctn1 A G 6: 83,179,892 H7R probably benign Het
Dscam A C 16: 96,673,736 W1209G probably damaging Het
Fuk C T 8: 110,893,768 probably benign Het
Gna11 A G 10: 81,530,940 M312T probably benign Het
Hacd2 T A 16: 35,075,627 V105D probably damaging Het
Htra4 C A 8: 25,038,808 V23L probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Msh4 C T 3: 153,869,681 A686T probably benign Het
Nbas T A 12: 13,390,957 M1096K probably benign Het
Olfr1022 C A 2: 85,869,253 Y220* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prlr A G 15: 10,328,423 Y328C probably damaging Het
Ros1 C T 10: 52,180,191 V68I probably benign Het
Shmt2 G A 10: 127,521,048 T31M possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tmem175 C T 5: 108,639,562 H92Y probably damaging Het
Top3a C T 11: 60,740,684 A951T probably benign Het
Trpc4ap T C 2: 155,640,486 E528G possibly damaging Het
Trpm6 T C 19: 18,786,755 C242R probably benign Het
Vwa7 G A 17: 35,024,547 S710N possibly damaging Het
Zfa-ps A T 10: 52,545,106 noncoding transcript Het
Zfp770 T A 2: 114,197,232 R119* probably null Het
Other mutations in Tas2r135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Tas2r135 APN 6 42406144 missense probably benign 0.00
IGL01395:Tas2r135 APN 6 42405912 nonsense probably null
IGL02479:Tas2r135 APN 6 42405751 nonsense probably null
IGL02526:Tas2r135 APN 6 42406280 missense probably damaging 1.00
IGL02806:Tas2r135 APN 6 42406448 missense probably benign 0.00
IGL02982:Tas2r135 APN 6 42406253 missense probably benign
IGL03057:Tas2r135 APN 6 42401127 unclassified probably benign
R0104:Tas2r135 UTSW 6 42406324 missense possibly damaging 0.79
R1412:Tas2r135 UTSW 6 42405834 missense probably benign 0.00
R4517:Tas2r135 UTSW 6 42406079 missense probably benign
R4629:Tas2r135 UTSW 6 42406226 missense probably benign 0.03
R5788:Tas2r135 UTSW 6 42405597 missense probably damaging 1.00
R6021:Tas2r135 UTSW 6 42406387 missense probably damaging 1.00
R6586:Tas2r135 UTSW 6 42406018 missense probably benign 0.18
R7180:Tas2r135 UTSW 6 42405751 nonsense probably null
R7458:Tas2r135 UTSW 6 42405947 missense possibly damaging 0.95
R7850:Tas2r135 UTSW 6 42406138 missense probably benign
R7933:Tas2r135 UTSW 6 42406138 missense probably benign
Z1176:Tas2r135 UTSW 6 42406234 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCCCTTTCAGAACTTCGGGATG -3'
(R):5'- GAGCCCACCTTGAATCCTATGCAC -3'

Sequencing Primer
(F):5'- TTCTGACGCTGGTACTCAGT -3'
(R):5'- TGTTCCACTGCCATTCAGGC -3'
Posted On2014-07-21