Mutagenetix > Incidental Mutation

Incidental Mutation 'R0322:Ankhd1'

216108

Institutional Source

Beutler Lab

Gene Symbol

Ankhd1

Ensembl Gene

ENSMUSG00000024483

Gene Name

ankyrin repeat and KH domain containing 1

Synonyms

A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik

MMRRC Submission

038532-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0322 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

36693656-36791961 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 36791061 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2478 (Y2478*)

Ref Sequence

ENSEMBL: ENSMUSP00000120290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]

AlphaFold

E9PUR0

Predicted Effect

probably null
Transcript: ENSMUST00000006205
AA Change: Y2478*

SMART Domains

Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: Y2478*

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037072
AA Change: I958K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: I958K

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	28	47	N/A	INTRINSIC
low complexity region	75	94	N/A	INTRINSIC
KH	183	253	5.04e-13	SMART
low complexity region	458	491	N/A	INTRINSIC
low complexity region	531	547	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
low complexity region	824	836	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000116653
AA Change: I106K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140061
AA Change: I498K

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483
AA Change: I498K

Domain	Start	End	E-Value	Type
low complexity region	54	70	N/A	INTRINSIC
low complexity region	77	94	N/A	INTRINSIC
low complexity region	355	375	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000142977
AA Change: Y2478*

SMART Domains

Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: Y2478*

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000155329
AA Change: I2486K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: I2486K

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2342	2362	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.8%
20x: 84.3%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 57,888,768 (GRCm39)	S275T	possibly damaging	Het
Adam34	G	T	8: 44,104,958 (GRCm39)	T229N	probably benign	Het
Adgrb3	C	A	1: 25,260,829 (GRCm39)		probably benign	Het
Arl9	A	G	5: 77,155,037 (GRCm39)		probably benign	Het
Bub1b	G	A	2: 118,470,099 (GRCm39)		probably benign	Het
Chl1	A	T	6: 103,678,844 (GRCm39)		probably benign	Het
Cobl	T	A	11: 12,217,072 (GRCm39)	E465V	probably damaging	Het
Cobll1	A	T	2: 64,932,442 (GRCm39)	M520K	possibly damaging	Het
Dll3	A	G	7: 27,995,793 (GRCm39)	V336A	possibly damaging	Het
Dnmbp	T	C	19: 43,843,285 (GRCm39)	H1193R	probably damaging	Het
Fbxo43	T	C	15: 36,152,338 (GRCm39)		probably benign	Het
Gart	G	A	16: 91,419,925 (GRCm39)		probably benign	Het
Gjc3	A	T	5: 137,955,760 (GRCm39)	M175K	possibly damaging	Het
Gpc5	T	A	14: 115,636,563 (GRCm39)	N415K	probably benign	Het
Idh2	C	T	7: 79,748,005 (GRCm39)	A232T	probably damaging	Het
Il7r	A	T	15: 9,510,301 (GRCm39)	F251I	probably benign	Het
Insc	A	G	7: 114,391,500 (GRCm39)	E141G	probably damaging	Het
Itm2c	C	T	1: 85,834,751 (GRCm39)	T160M	probably damaging	Het
Mboat1	T	C	13: 30,416,063 (GRCm39)		probably benign	Het
Mdm2	G	T	10: 117,538,109 (GRCm39)	H96Q	possibly damaging	Het
Mettl13	A	G	1: 162,371,745 (GRCm39)		probably benign	Het
Mfsd4b3-ps	T	C	10: 39,823,526 (GRCm39)	N245D	probably damaging	Het
Mroh2a	C	T	1: 88,158,402 (GRCm39)	R150*	probably null	Het
Mtmr3	T	C	11: 4,437,505 (GRCm39)	Y982C	possibly damaging	Het
Mymk	A	T	2: 26,957,418 (GRCm39)	L66Q	probably damaging	Het
Myo18a	T	C	11: 77,720,626 (GRCm39)	S767P	probably damaging	Het
Ndufa8	T	C	2: 35,926,634 (GRCm39)	D134G	probably benign	Het
Noxa1	A	G	2: 24,982,566 (GRCm39)	F83S	probably damaging	Het
Npc1l1	T	A	11: 6,179,042 (GRCm39)	I123L	probably benign	Het
Ogdhl	A	G	14: 32,059,534 (GRCm39)	T394A	probably benign	Het
Or4s2b	T	C	2: 88,509,011 (GRCm39)	S264P	probably damaging	Het
Or5ae1	A	G	7: 84,565,521 (GRCm39)	Y178C	probably damaging	Het
Pcdh20	T	C	14: 88,706,383 (GRCm39)	T306A	probably benign	Het
Pcid2	G	A	8: 13,140,775 (GRCm39)		probably benign	Het
Phyhip	G	A	14: 70,700,836 (GRCm39)	V108M	possibly damaging	Het
Pnpla5	G	T	15: 84,004,920 (GRCm39)	L144M	probably damaging	Het
Psmb4	A	G	3: 94,793,402 (GRCm39)	Y160H	probably benign	Het
Riox2	A	T	16: 59,309,752 (GRCm39)	K369*	probably null	Het
Rnf26rt	T	C	6: 76,473,401 (GRCm39)	Y405C	probably benign	Het
Sh3tc1	G	A	5: 35,863,905 (GRCm39)	P761S	possibly damaging	Het
Slc6a3	T	A	13: 73,709,045 (GRCm39)	V323D	possibly damaging	Het
Smg7	A	G	1: 152,725,624 (GRCm39)		probably null	Het
Srrt	G	A	5: 137,294,870 (GRCm39)	R370C	probably damaging	Het
Stc1	T	C	14: 69,266,858 (GRCm39)	V7A	probably benign	Het
Svep1	G	T	4: 58,057,996 (GRCm39)		probably benign	Het
Tbpl2	A	G	2: 23,984,991 (GRCm39)	V51A	probably benign	Het
Tecr	A	G	8: 84,298,872 (GRCm39)	Y248H	probably damaging	Het
Tenm3	A	G	8: 48,689,947 (GRCm39)		probably benign	Het
Tia1	C	T	6: 86,397,369 (GRCm39)	A114V	probably damaging	Het
Tmprss11f	A	T	5: 86,739,275 (GRCm39)	M2K	probably benign	Het
Tnfsf8	T	C	4: 63,752,403 (GRCm39)	T221A	probably damaging	Het
Tubgcp5	G	A	7: 55,464,726 (GRCm39)	G536S	probably damaging	Het
Tyr	A	T	7: 87,142,125 (GRCm39)	I145N	probably benign	Het
Ubr4	T	A	4: 139,149,729 (GRCm39)	V1809E	probably damaging	Het
Vmn2r65	A	T	7: 84,595,756 (GRCm39)	N309K	probably benign	Het

Other mutations in Ankhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ankhd1	APN	18	36,798,512 (GRCm39)	unclassified	probably benign
IGL00927:Ankhd1	APN	18	36,765,125 (GRCm39)	missense	probably benign	0.01
IGL01367:Ankhd1	APN	18	36,711,696 (GRCm39)	missense	probably benign	0.16
IGL01624:Ankhd1	APN	18	36,791,066 (GRCm39)	missense	probably damaging	1.00
IGL01725:Ankhd1	APN	18	36,781,206 (GRCm39)	missense	probably benign	0.04
IGL01767:Ankhd1	APN	18	36,781,427 (GRCm39)	missense	probably damaging	1.00
IGL02005:Ankhd1	APN	18	36,781,479 (GRCm39)	missense	probably damaging	1.00
IGL02009:Ankhd1	APN	18	36,757,714 (GRCm39)	missense	probably damaging	1.00
IGL02246:Ankhd1	APN	18	36,789,779 (GRCm39)	missense	probably damaging	1.00
IGL02336:Ankhd1	APN	18	36,727,867 (GRCm39)	missense	probably damaging	0.97
IGL02628:Ankhd1	APN	18	36,780,756 (GRCm39)	missense	probably benign	0.00
IGL02644:Ankhd1	APN	18	36,711,828 (GRCm39)	critical splice donor site	probably null
IGL02735:Ankhd1	APN	18	36,781,599 (GRCm39)	missense	probably benign	0.00
IGL02877:Ankhd1	APN	18	36,727,876 (GRCm39)	missense	probably damaging	1.00
IGL03129:Ankhd1	APN	18	36,791,061 (GRCm39)	nonsense	probably null
IGL03163:Ankhd1	APN	18	36,780,681 (GRCm39)	missense	probably damaging	0.97
IGL03182:Ankhd1	APN	18	36,711,827 (GRCm39)	missense	probably benign	0.06
IGL03184:Ankhd1	APN	18	36,780,830 (GRCm39)	missense	probably damaging	1.00
IGL03398:Ankhd1	APN	18	36,789,890 (GRCm39)	splice site	probably benign
FR4304:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
R0051:Ankhd1	UTSW	18	36,780,241 (GRCm39)	unclassified	probably benign
R0089:Ankhd1	UTSW	18	36,773,409 (GRCm39)	missense	probably damaging	0.99
R0105:Ankhd1	UTSW	18	36,779,819 (GRCm39)	missense	probably damaging	1.00
R0149:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0243:Ankhd1	UTSW	18	36,767,787 (GRCm39)	missense	probably damaging	1.00
R0361:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0389:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0418:Ankhd1	UTSW	18	36,767,353 (GRCm39)	missense	probably damaging	1.00
R0443:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0540:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0607:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0738:Ankhd1	UTSW	18	36,778,302 (GRCm39)	splice site	probably benign
R1127:Ankhd1	UTSW	18	36,767,399 (GRCm39)	missense	probably damaging	1.00
R1434:Ankhd1	UTSW	18	36,758,212 (GRCm39)	missense	probably benign	0.09
R1742:Ankhd1	UTSW	18	36,758,318 (GRCm39)	missense	probably damaging	1.00
R1776:Ankhd1	UTSW	18	36,780,361 (GRCm39)	missense	probably benign	0.17
R1856:Ankhd1	UTSW	18	36,777,580 (GRCm39)	missense	probably benign	0.00
R1923:Ankhd1	UTSW	18	36,781,083 (GRCm39)	missense	probably benign	0.08
R2044:Ankhd1	UTSW	18	36,778,166 (GRCm39)	missense	probably benign	0.31
R2112:Ankhd1	UTSW	18	36,774,679 (GRCm39)	missense	probably damaging	1.00
R2115:Ankhd1	UTSW	18	36,767,361 (GRCm39)	missense	probably damaging	1.00
R2136:Ankhd1	UTSW	18	36,780,674 (GRCm39)	missense	probably benign
R2196:Ankhd1	UTSW	18	36,781,432 (GRCm39)	missense	probably damaging	1.00
R2291:Ankhd1	UTSW	18	36,777,386 (GRCm39)	missense	probably benign	0.31
R2305:Ankhd1	UTSW	18	36,775,979 (GRCm39)	missense	possibly damaging	0.59
R2309:Ankhd1	UTSW	18	36,757,818 (GRCm39)	missense	probably damaging	1.00
R2519:Ankhd1	UTSW	18	36,711,596 (GRCm39)	splice site	probably null
R2958:Ankhd1	UTSW	18	36,767,782 (GRCm39)	missense	probably damaging	1.00
R3978:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R3980:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R4159:Ankhd1	UTSW	18	36,722,593 (GRCm39)	missense	possibly damaging	0.91
R4199:Ankhd1	UTSW	18	36,794,101 (GRCm39)	unclassified	probably benign
R4323:Ankhd1	UTSW	18	36,711,686 (GRCm39)	missense	probably damaging	1.00
R4356:Ankhd1	UTSW	18	36,776,096 (GRCm39)	nonsense	probably null
R4496:Ankhd1	UTSW	18	36,693,839 (GRCm39)	missense	probably damaging	0.98
R4551:Ankhd1	UTSW	18	36,788,560 (GRCm39)	splice site	probably null
R4590:Ankhd1	UTSW	18	36,716,697 (GRCm39)	missense	probably damaging	1.00
R4667:Ankhd1	UTSW	18	36,781,074 (GRCm39)	missense	possibly damaging	0.77
R4889:Ankhd1	UTSW	18	36,711,787 (GRCm39)	missense	probably null	0.00
R4923:Ankhd1	UTSW	18	36,722,505 (GRCm39)	missense	probably damaging	1.00
R5091:Ankhd1	UTSW	18	36,758,080 (GRCm39)	missense	possibly damaging	0.68
R5254:Ankhd1	UTSW	18	36,789,768 (GRCm39)	missense	probably benign	0.05
R5314:Ankhd1	UTSW	18	36,694,111 (GRCm39)	splice site	probably null
R5336:Ankhd1	UTSW	18	36,779,769 (GRCm39)	missense	probably damaging	1.00
R5367:Ankhd1	UTSW	18	36,722,461 (GRCm39)	missense	probably damaging	1.00
R5384:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5385:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5387:Ankhd1	UTSW	18	36,767,697 (GRCm39)	missense	probably damaging	1.00
R5458:Ankhd1	UTSW	18	36,781,538 (GRCm39)	missense	probably benign	0.01
R5599:Ankhd1	UTSW	18	36,693,860 (GRCm39)	missense	probably damaging	0.98
R5659:Ankhd1	UTSW	18	36,694,103 (GRCm39)	missense	probably damaging	1.00
R5750:Ankhd1	UTSW	18	36,757,955 (GRCm39)	missense	probably benign	0.00
R5874:Ankhd1	UTSW	18	36,773,322 (GRCm39)	missense	possibly damaging	0.92
R5894:Ankhd1	UTSW	18	36,780,577 (GRCm39)	missense	probably damaging	0.99
R5969:Ankhd1	UTSW	18	36,733,887 (GRCm39)	missense	probably damaging	1.00
R6133:Ankhd1	UTSW	18	36,758,179 (GRCm39)	missense	possibly damaging	0.77
R6190:Ankhd1	UTSW	18	36,744,862 (GRCm39)	missense	possibly damaging	0.84
R6247:Ankhd1	UTSW	18	36,787,199 (GRCm39)	missense	probably benign	0.00
R6512:Ankhd1	UTSW	18	36,724,509 (GRCm39)	missense	probably damaging	1.00
R6649:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6653:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6763:Ankhd1	UTSW	18	36,776,022 (GRCm39)	missense	probably benign	0.31
R6976:Ankhd1	UTSW	18	36,781,307 (GRCm39)	missense	probably benign	0.00
R7075:Ankhd1	UTSW	18	36,693,042 (GRCm39)	missense
R7208:Ankhd1	UTSW	18	36,758,081 (GRCm39)	missense	probably benign
R7305:Ankhd1	UTSW	18	36,765,258 (GRCm39)	missense
R7615:Ankhd1	UTSW	18	36,789,826 (GRCm39)	missense
R7654:Ankhd1	UTSW	18	36,727,154 (GRCm39)	missense	probably damaging	1.00
R7781:Ankhd1	UTSW	18	36,758,258 (GRCm39)	missense	probably damaging	1.00
R7842:Ankhd1	UTSW	18	36,780,881 (GRCm39)	missense	probably benign	0.00
R7965:Ankhd1	UTSW	18	36,791,465 (GRCm39)	missense
R8006:Ankhd1	UTSW	18	36,781,772 (GRCm39)	missense
R8037:Ankhd1	UTSW	18	36,771,676 (GRCm39)	missense	probably damaging	0.98
R8123:Ankhd1	UTSW	18	36,708,136 (GRCm39)	missense
R8195:Ankhd1	UTSW	18	36,787,230 (GRCm39)	missense
R8305:Ankhd1	UTSW	18	36,780,219 (GRCm39)	missense	possibly damaging	0.79
R8708:Ankhd1	UTSW	18	36,727,344 (GRCm39)	missense	probably damaging	1.00
R8827:Ankhd1	UTSW	18	36,757,633 (GRCm39)	nonsense	probably null
R9138:Ankhd1	UTSW	18	36,693,961 (GRCm39)	small deletion	probably benign
R9139:Ankhd1	UTSW	18	36,711,810 (GRCm39)	missense
R9186:Ankhd1	UTSW	18	36,767,383 (GRCm39)	missense	possibly damaging	0.95
R9245:Ankhd1	UTSW	18	36,788,653 (GRCm39)	missense
R9254:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9262:Ankhd1	UTSW	18	36,765,799 (GRCm39)	missense
R9379:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9436:Ankhd1	UTSW	18	36,774,654 (GRCm39)	missense	probably benign	0.04
R9436:Ankhd1	UTSW	18	36,694,041 (GRCm39)	missense	probably benign	0.39
R9541:Ankhd1	UTSW	18	36,757,697 (GRCm39)	missense
R9584:Ankhd1	UTSW	18	36,798,504 (GRCm39)	missense	probably benign	0.06
R9664:Ankhd1	UTSW	18	36,780,878 (GRCm39)	missense	probably benign	0.03
RF001:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF004:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF007:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF008:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
RF009:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF013:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF017:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF018:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF026:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,966 (GRCm39)	small insertion	probably benign
RF039:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
RF043:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF046:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF049:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF050:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF054:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF057:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF060:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF061:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF062:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
X0027:Ankhd1	UTSW	18	36,757,885 (GRCm39)	missense	probably damaging	1.00
X0065:Ankhd1	UTSW	18	36,711,817 (GRCm39)	nonsense	probably null
X0066:Ankhd1	UTSW	18	36,779,757 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACACTTGATTCTCCATCCTGTACCG -3'
(R):5'- GCAATGCACTGTTTCTGCCTAGAAAG -3'

Sequencing Primer
(F):5'- CTCCATCCTGTACCGTGATATAC -3'
(R):5'- GCACTGTTTCTGCCTAGAAAGAATAC -3'

Posted On

2014-07-21