Incidental Mutation 'R0357:Def6'
ID 216115
Institutional Source Beutler Lab
Gene Symbol Def6
Ensembl Gene ENSMUSG00000002257
Gene Name differentially expressed in FDCP 6
Synonyms IBP, SLAT, 6430538D02Rik, IRF-4-binding protein, 2410003F05Rik
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0357 (G1)
Quality Score 65
Status Validated
Chromosome 17
Chromosomal Location 28207778-28228608 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28223935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 322 (H322Y)
Ref Sequence ENSEMBL: ENSMUSP00000002327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002327]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002327
AA Change: H322Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: H322Y

DomainStartEndE-ValueType
low complexity region 145 166 N/A INTRINSIC
PH 217 314 3.87e-20 SMART
coiled coil region 318 551 N/A INTRINSIC
Meta Mutation Damage Score 0.1929 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Def6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Def6 APN 17 28219740 splice site probably benign
IGL01619:Def6 APN 17 28207864 missense probably damaging 1.00
IGL01737:Def6 APN 17 28223727 missense possibly damaging 0.94
IGL02550:Def6 APN 17 28228261 missense probably benign 0.03
Huntsville UTSW 17 28219976 missense probably damaging 0.99
Redstone UTSW 17 28217755 missense probably damaging 1.00
Silos UTSW 17 28217092 missense probably damaging 1.00
R0013:Def6 UTSW 17 28217092 missense probably damaging 1.00
R0335:Def6 UTSW 17 28228069 missense possibly damaging 0.83
R0373:Def6 UTSW 17 28220180 missense probably damaging 0.96
R1161:Def6 UTSW 17 28217619 missense probably benign 0.00
R1310:Def6 UTSW 17 28217619 missense probably benign 0.00
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1636:Def6 UTSW 17 28223918 missense possibly damaging 0.95
R1778:Def6 UTSW 17 28220186 missense probably benign 0.02
R2432:Def6 UTSW 17 28228069 missense probably benign 0.03
R3881:Def6 UTSW 17 28220215 missense probably damaging 1.00
R4402:Def6 UTSW 17 28219976 missense probably damaging 0.99
R4589:Def6 UTSW 17 28228147 missense probably benign
R4683:Def6 UTSW 17 28217635 missense probably damaging 0.99
R5704:Def6 UTSW 17 28228226 missense probably benign
R6481:Def6 UTSW 17 28226163 missense probably benign 0.00
R6805:Def6 UTSW 17 28223717 missense probably damaging 1.00
R7029:Def6 UTSW 17 28225969 missense probably benign 0.05
R7863:Def6 UTSW 17 28227867 missense possibly damaging 0.62
R8229:Def6 UTSW 17 28217755 missense probably damaging 1.00
R8856:Def6 UTSW 17 28216998 missense probably damaging 1.00
R9297:Def6 UTSW 17 28217740 missense probably damaging 1.00
R9671:Def6 UTSW 17 28219781 missense probably benign 0.04
R9684:Def6 UTSW 17 28217070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATGAGATGAGCGCCTCAGAC -3'
(R):5'- TTAGGCCATGCCCAAAGCATCCAG -3'

Sequencing Primer
(F):5'- CCTCAGACACCCGCCAG -3'
(R):5'- AGGTCCATCCTTCAGCCAATG -3'
Posted On 2014-07-22