Incidental Mutation 'R0357:Def6'
ID 216115
Institutional Source Beutler Lab
Gene Symbol Def6
Ensembl Gene ENSMUSG00000002257
Gene Name differentially expressed in FDCP 6
Synonyms SLAT, 2410003F05Rik, 6430538D02Rik, IRF-4-binding protein, IBP
MMRRC Submission 038563-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0357 (G1)
Quality Score 65
Status Validated
Chromosome 17
Chromosomal Location 28426752-28447582 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28442909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 322 (H322Y)
Ref Sequence ENSEMBL: ENSMUSP00000002327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002327]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002327
AA Change: H322Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: H322Y

DomainStartEndE-ValueType
low complexity region 145 166 N/A INTRINSIC
PH 217 314 3.87e-20 SMART
coiled coil region 318 551 N/A INTRINSIC
Meta Mutation Damage Score 0.1929 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 T C 5: 24,778,463 (GRCm39) K232E probably benign Het
AI837181 C T 19: 5,476,731 (GRCm39) T298I possibly damaging Het
Alox12 T C 11: 70,133,362 (GRCm39) Y614C probably damaging Het
Amn A T 12: 111,240,575 (GRCm39) probably null Het
Ankrd33b A G 15: 31,305,272 (GRCm39) S121P probably benign Het
Aox1 A G 1: 58,131,675 (GRCm39) Y1028C probably damaging Het
Asph C A 4: 9,453,314 (GRCm39) R736L probably benign Het
Atp2a3 G A 11: 72,861,757 (GRCm39) probably null Het
Cables2 T C 2: 179,904,025 (GRCm39) probably benign Het
Catsperg2 A T 7: 29,414,326 (GRCm39) Y360N possibly damaging Het
Cdh4 T C 2: 179,489,133 (GRCm39) S282P probably damaging Het
Col5a3 C T 9: 20,719,064 (GRCm39) probably benign Het
Ctso A T 3: 81,858,850 (GRCm39) probably benign Het
Cyp4f13 A T 17: 33,151,625 (GRCm39) Y125* probably null Het
Dapk1 T A 13: 60,877,372 (GRCm39) L537* probably null Het
Ddit4l G A 3: 137,331,946 (GRCm39) R104Q probably benign Het
Dnaaf9 A T 2: 130,554,866 (GRCm39) probably benign Het
Dnah6 T C 6: 73,165,342 (GRCm39) N588D probably benign Het
Dzip1 T A 14: 119,146,950 (GRCm39) I320F probably damaging Het
Epb41l5 T C 1: 119,536,934 (GRCm39) H319R probably damaging Het
Erc2 A G 14: 27,498,979 (GRCm39) E285G probably damaging Het
Fat4 G A 3: 38,945,376 (GRCm39) G1423E probably damaging Het
Foxp2 C T 6: 15,409,839 (GRCm39) P480S probably damaging Het
Gadd45gip1 G A 8: 85,560,762 (GRCm39) A126T probably damaging Het
Gbp5 G A 3: 142,211,172 (GRCm39) D301N probably benign Het
Gm10360 T C 6: 70,401,297 (GRCm39) noncoding transcript Het
Gm6471 T A 7: 142,387,604 (GRCm39) noncoding transcript Het
Gm8674 T A 13: 50,056,149 (GRCm39) noncoding transcript Het
H2bc18 A C 3: 96,177,104 (GRCm39) K13Q probably null Het
Ift172 A G 5: 31,415,244 (GRCm39) S1322P possibly damaging Het
Ift80 A T 3: 68,821,986 (GRCm39) Y686* probably null Het
Insrr A C 3: 87,715,953 (GRCm39) probably null Het
Itprid1 T A 6: 55,945,019 (GRCm39) M580K probably benign Het
Krt87 C T 15: 101,384,900 (GRCm39) V399M probably benign Het
Macf1 T C 4: 123,351,776 (GRCm39) N3708S probably damaging Het
Matcap1 A T 8: 106,011,699 (GRCm39) V222E probably damaging Het
Mogat1 T C 1: 78,488,677 (GRCm39) S27P probably benign Het
Mrgpra4 A T 7: 47,631,574 (GRCm39) M9K probably benign Het
Mtus1 A T 8: 41,536,563 (GRCm39) S384R possibly damaging Het
Myo1a T A 10: 127,546,771 (GRCm39) M306K probably benign Het
Noxa1 G T 2: 24,975,862 (GRCm39) D403E probably damaging Het
Ogdhl T C 14: 32,068,415 (GRCm39) V884A possibly damaging Het
Or10ak12 A C 4: 118,666,614 (GRCm39) L149R probably damaging Het
Or2y1f A G 11: 49,184,613 (GRCm39) N155S probably damaging Het
Or6k4 T A 1: 173,964,865 (GRCm39) L185* probably null Het
Or6n1 T C 1: 173,916,675 (GRCm39) V23A possibly damaging Het
Paxip1 G A 5: 27,963,621 (GRCm39) probably benign Het
Paxx T A 2: 25,350,079 (GRCm39) E145D probably damaging Het
Pde4d T C 13: 110,087,802 (GRCm39) V560A possibly damaging Het
Pheta2 C T 15: 82,227,517 (GRCm39) A12V probably damaging Het
Plxnd1 C T 6: 115,946,421 (GRCm39) V847M probably benign Het
Polk T A 13: 96,641,105 (GRCm39) M151L probably damaging Het
Ptprq C T 10: 107,522,060 (GRCm39) probably benign Het
Pum2 A G 12: 8,771,785 (GRCm39) Q371R possibly damaging Het
Reln G A 5: 22,155,820 (GRCm39) A2224V probably damaging Het
Rmc1 T C 18: 12,312,266 (GRCm39) S169P possibly damaging Het
Scart1 T G 7: 139,807,808 (GRCm39) C660G probably damaging Het
Shroom1 A G 11: 53,356,035 (GRCm39) T362A probably damaging Het
Smarcd2 A G 11: 106,158,158 (GRCm39) probably null Het
Spg11 A C 2: 121,896,713 (GRCm39) probably benign Het
Tcaf3 T A 6: 42,566,761 (GRCm39) Y776F probably damaging Het
Thada A G 17: 84,538,364 (GRCm39) V1548A probably damaging Het
Trpv2 C T 11: 62,481,130 (GRCm39) P410S probably damaging Het
Ube2u G T 4: 100,338,851 (GRCm39) E39* probably null Het
Ulbp3 A T 10: 3,070,307 (GRCm39) noncoding transcript Het
Ulbp3 A G 10: 3,075,788 (GRCm39) noncoding transcript Het
Vmn2r2 C T 3: 64,041,320 (GRCm39) probably null Het
Vmn2r24 TCC TC 6: 123,792,369 (GRCm39) probably null Het
Wdr87-ps A T 7: 29,235,007 (GRCm39) noncoding transcript Het
Zfp110 A G 7: 12,570,302 (GRCm39) Y43C probably damaging Het
Zfp605 A G 5: 110,272,245 (GRCm39) T55A probably benign Het
Other mutations in Def6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Def6 APN 17 28,438,714 (GRCm39) splice site probably benign
IGL01619:Def6 APN 17 28,426,838 (GRCm39) missense probably damaging 1.00
IGL01737:Def6 APN 17 28,442,701 (GRCm39) missense possibly damaging 0.94
IGL02550:Def6 APN 17 28,447,235 (GRCm39) missense probably benign 0.03
Huntsville UTSW 17 28,438,950 (GRCm39) missense probably damaging 0.99
Redstone UTSW 17 28,436,729 (GRCm39) missense probably damaging 1.00
Silos UTSW 17 28,436,066 (GRCm39) missense probably damaging 1.00
R0013:Def6 UTSW 17 28,436,066 (GRCm39) missense probably damaging 1.00
R0335:Def6 UTSW 17 28,447,043 (GRCm39) missense possibly damaging 0.83
R0373:Def6 UTSW 17 28,439,154 (GRCm39) missense probably damaging 0.96
R1161:Def6 UTSW 17 28,436,593 (GRCm39) missense probably benign 0.00
R1310:Def6 UTSW 17 28,436,593 (GRCm39) missense probably benign 0.00
R1470:Def6 UTSW 17 28,444,956 (GRCm39) missense possibly damaging 0.67
R1470:Def6 UTSW 17 28,444,956 (GRCm39) missense possibly damaging 0.67
R1636:Def6 UTSW 17 28,442,892 (GRCm39) missense possibly damaging 0.95
R1778:Def6 UTSW 17 28,439,160 (GRCm39) missense probably benign 0.02
R2432:Def6 UTSW 17 28,447,043 (GRCm39) missense probably benign 0.03
R3881:Def6 UTSW 17 28,439,189 (GRCm39) missense probably damaging 1.00
R4402:Def6 UTSW 17 28,438,950 (GRCm39) missense probably damaging 0.99
R4589:Def6 UTSW 17 28,447,121 (GRCm39) missense probably benign
R4683:Def6 UTSW 17 28,436,609 (GRCm39) missense probably damaging 0.99
R5704:Def6 UTSW 17 28,447,200 (GRCm39) missense probably benign
R6481:Def6 UTSW 17 28,445,137 (GRCm39) missense probably benign 0.00
R6805:Def6 UTSW 17 28,442,691 (GRCm39) missense probably damaging 1.00
R7029:Def6 UTSW 17 28,444,943 (GRCm39) missense probably benign 0.05
R7863:Def6 UTSW 17 28,446,841 (GRCm39) missense possibly damaging 0.62
R8229:Def6 UTSW 17 28,436,729 (GRCm39) missense probably damaging 1.00
R8856:Def6 UTSW 17 28,435,972 (GRCm39) missense probably damaging 1.00
R9297:Def6 UTSW 17 28,436,714 (GRCm39) missense probably damaging 1.00
R9671:Def6 UTSW 17 28,438,755 (GRCm39) missense probably benign 0.04
R9684:Def6 UTSW 17 28,436,044 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATGAGATGAGCGCCTCAGAC -3'
(R):5'- TTAGGCCATGCCCAAAGCATCCAG -3'

Sequencing Primer
(F):5'- CCTCAGACACCCGCCAG -3'
(R):5'- AGGTCCATCCTTCAGCCAATG -3'
Posted On 2014-07-22