Incidental Mutation 'R0374:Mroh2a'
ID216117
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 038580-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R0374 (G1)
Quality Score40
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88242420 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 685 (A685D)
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061013
AA Change: A688D

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: A688D

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113130
AA Change: A685D

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: A685D

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142632
Meta Mutation Damage Score 0.2131 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,248,961 C178S probably damaging Het
Ano9 A G 7: 141,107,814 I267T probably damaging Het
Anxa6 T A 11: 55,005,828 N168I probably benign Het
Apbb1ip A G 2: 22,819,705 probably benign Het
Aqr G A 2: 114,130,611 H723Y probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Car13 A G 3: 14,656,297 probably benign Het
Casp9 T A 4: 141,807,173 I298N possibly damaging Het
Ccdc66 T C 14: 27,498,473 E261G probably damaging Het
Cep192 T A 18: 67,818,883 Y376* probably null Het
Cped1 T A 6: 22,222,546 probably benign Het
Ctbp2 A T 7: 132,999,344 S563R possibly damaging Het
Ctdp1 A G 18: 80,447,422 probably null Het
Dgka G C 10: 128,721,083 probably benign Het
Drd2 A G 9: 49,399,784 T112A probably benign Het
Dusp1 A G 17: 26,508,169 V52A probably damaging Het
Eea1 T A 10: 96,039,772 probably benign Het
Etfrf1 T C 6: 145,215,562 V86A probably benign Het
Fbn1 A T 2: 125,321,676 C2087S possibly damaging Het
Fosb T G 7: 19,307,150 R139S probably damaging Het
Foxm1 C T 6: 128,372,603 R362W probably damaging Het
Frem2 A G 3: 53,653,960 V1042A probably damaging Het
Gbe1 A G 16: 70,483,914 H401R probably benign Het
Gm10549 C T 18: 33,464,182 probably benign Het
Golga7b A T 19: 42,263,319 probably benign Het
H2-DMb1 T C 17: 34,159,425 V235A probably benign Het
Hr A G 14: 70,556,476 T59A probably benign Het
Itpr2 C A 6: 146,359,392 A588S probably benign Het
Kmt2c G A 5: 25,309,708 P3046S probably damaging Het
Lamc1 G A 1: 153,251,065 probably benign Het
Lrp2 A G 2: 69,430,307 Y4527H probably damaging Het
Map3k2 G A 18: 32,212,173 probably null Het
Nfs1 C G 2: 156,132,660 G212R probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nrap T A 19: 56,351,622 Y740F probably damaging Het
Nup205 T A 6: 35,208,837 M859K probably damaging Het
Nxf1 T C 19: 8,767,739 F451S possibly damaging Het
Olfr262 A T 19: 12,241,141 N173K probably damaging Het
Olfr804 G A 10: 129,705,647 M256I probably benign Het
Pcdhac2 T C 18: 37,145,667 Y567H probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pi4ka A G 16: 17,282,932 probably benign Het
Pmpcb A G 5: 21,748,831 D359G probably damaging Het
Poll T G 19: 45,557,870 S244R probably benign Het
Prkd3 T C 17: 78,957,215 D657G probably null Het
Prune2 G A 19: 17,120,910 M1259I probably benign Het
Ptpra T A 2: 130,537,621 M329K probably damaging Het
Rbm10 GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG X: 20,637,559 probably benign Het
Rbm15 G T 3: 107,330,564 D839E probably damaging Het
Sap30bp T A 11: 115,964,277 I271N probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setdb1 A T 3: 95,324,853 probably benign Het
Sgk3 T A 1: 9,879,081 probably null Het
Shox2 A T 3: 66,973,851 H265Q probably damaging Het
Slc9a2 T C 1: 40,743,857 F427S possibly damaging Het
Smarca5 T A 8: 80,736,731 Q69H probably benign Het
Specc1l T A 10: 75,248,459 F672Y probably damaging Het
Ssh2 T A 11: 77,408,143 S105R probably damaging Het
Syne2 C T 12: 75,921,226 R917* probably null Het
Tbc1d2 G A 4: 46,649,913 T41M possibly damaging Het
Tbx18 T A 9: 87,724,355 I246F probably damaging Het
Tcf4 T A 18: 69,681,812 probably benign Het
Tmed2 C A 5: 124,541,439 probably null Het
Tmem243 A T 5: 9,101,361 D15V possibly damaging Het
Vmn2r87 T A 10: 130,471,979 S797C probably damaging Het
Vps13c T A 9: 67,886,246 probably benign Het
Wls T A 3: 159,897,437 C162* probably null Het
Zbtb7c C T 18: 76,137,393 T184I probably benign Het
Zc3h13 A G 14: 75,308,965 K169E probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
RF024:Mroh2a UTSW 1 88242485 missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers
Posted On2014-07-24