Incidental Mutation 'R0130:Sh2b1'
ID 21612
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene Name SH2B adaptor protein 1
Synonyms SH2-Bb, Sh2bpsm1, Irip, SH2-B
MMRRC Submission 038415-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.308) question?
Stock # R0130 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 126066166-126074596 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 126070620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 360 (D360E)
Ref Sequence ENSEMBL: ENSMUSP00000146121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206664] [ENSMUST00000206643]
AlphaFold Q91ZM2
Predicted Effect possibly damaging
Transcript: ENSMUST00000032978
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733
AA Change: D360E

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205340
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205440
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205497
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205733
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205889
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206515
Predicted Effect possibly damaging
Transcript: ENSMUST00000206664
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000206643
Meta Mutation Damage Score 0.5241 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,994,094 (GRCm39) Y37F probably damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Apol7c A G 15: 77,410,562 (GRCm39) I128T possibly damaging Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Arfip2 A G 7: 105,288,205 (GRCm39) probably benign Het
Atp5mf A T 5: 145,124,992 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
Cd22 A G 7: 30,569,389 (GRCm39) Y402H possibly damaging Het
Cd248 A G 19: 5,119,990 (GRCm39) T613A probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Cenpc1 A T 5: 86,194,405 (GRCm39) D120E probably benign Het
Chd3 T A 11: 69,250,656 (GRCm39) H691L probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
Ctnnd2 A T 15: 30,922,059 (GRCm39) E895V probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,585,108 (GRCm39) T837K probably benign Het
Eif2ak3 C A 6: 70,858,716 (GRCm39) probably benign Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Fat2 T A 11: 55,142,944 (GRCm39) M4302L probably benign Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Gde1 A T 7: 118,294,283 (GRCm39) F63L probably benign Het
Gjc3 A G 5: 137,956,202 (GRCm39) S28P probably benign Het
Gm10250 G A 15: 5,150,473 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k11 T C 19: 5,740,843 (GRCm39) L190P probably damaging Het
Mki67 T A 7: 135,298,188 (GRCm39) Q2282L probably damaging Het
Mthfd2 T A 6: 83,285,990 (GRCm39) I272F probably damaging Het
Myom1 A T 17: 71,352,750 (GRCm39) D358V probably damaging Het
Nebl T C 2: 17,395,737 (GRCm39) probably benign Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Nlrp2 T A 7: 5,325,417 (GRCm39) N14Y possibly damaging Het
Or14a258 T C 7: 86,035,514 (GRCm39) Y118C probably damaging Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pld2 T G 11: 70,445,174 (GRCm39) N591K probably benign Het
Plekha7 A G 7: 115,769,939 (GRCm39) M276T probably damaging Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Prtg A G 9: 72,716,998 (GRCm39) Y113C probably damaging Het
Rab38 T A 7: 88,099,749 (GRCm39) I88N probably damaging Het
Rbfox2 A G 15: 76,976,057 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sec14l1 A T 11: 117,047,233 (GRCm39) K637I possibly damaging Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Tectb G T 19: 55,170,393 (GRCm39) K81N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Tiam1 T C 16: 89,694,642 (GRCm39) M272V probably benign Het
Trav13-3 T A 14: 53,967,233 (GRCm39) noncoding transcript Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126,068,465 (GRCm39) missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126,068,341 (GRCm39) missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126,068,440 (GRCm39) missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126,071,646 (GRCm39) missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126,067,702 (GRCm39) missense possibly damaging 0.61
R0532:Sh2b1 UTSW 7 126,071,444 (GRCm39) missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126,071,862 (GRCm39) missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126,071,536 (GRCm39) missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126,070,651 (GRCm39) missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126,068,098 (GRCm39) missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126,067,959 (GRCm39) missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126,070,618 (GRCm39) missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126,067,975 (GRCm39) missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126,070,408 (GRCm39) missense probably benign
R5912:Sh2b1 UTSW 7 126,070,642 (GRCm39) missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126,067,685 (GRCm39) missense possibly damaging 0.59
R7694:Sh2b1 UTSW 7 126,066,929 (GRCm39) missense probably benign 0.03
R7801:Sh2b1 UTSW 7 126,070,464 (GRCm39) missense probably benign 0.15
R8005:Sh2b1 UTSW 7 126,068,479 (GRCm39) missense possibly damaging 0.82
R8353:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R8356:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R8453:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126,066,772 (GRCm39) nonsense probably null
R8456:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R8683:Sh2b1 UTSW 7 126,066,743 (GRCm39) utr 3 prime probably benign
R8906:Sh2b1 UTSW 7 126,070,292 (GRCm39) critical splice donor site probably null
R8921:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R8922:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126,066,743 (GRCm39) utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9269:Sh2b1 UTSW 7 126,068,354 (GRCm39) missense probably damaging 0.99
R9284:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9285:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9286:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126,066,756 (GRCm39) utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126,066,746 (GRCm39) utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126,066,750 (GRCm39) utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126,066,744 (GRCm39) utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126,066,762 (GRCm39) utr 3 prime probably benign
R9403:Sh2b1 UTSW 7 126,066,747 (GRCm39) utr 3 prime probably benign
R9403:Sh2b1 UTSW 7 126,066,745 (GRCm39) nonsense probably null
R9403:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9404:Sh2b1 UTSW 7 126,066,771 (GRCm39) utr 3 prime probably benign
R9404:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9467:Sh2b1 UTSW 7 126,066,754 (GRCm39) nonsense probably null
R9467:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
R9482:Sh2b1 UTSW 7 126,066,768 (GRCm39) utr 3 prime probably benign
R9495:Sh2b1 UTSW 7 126,066,744 (GRCm39) utr 3 prime probably benign
R9507:Sh2b1 UTSW 7 126,066,760 (GRCm39) utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126,066,765 (GRCm39) utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126,066,750 (GRCm39) utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126,066,770 (GRCm39) utr 3 prime probably benign
R9624:Sh2b1 UTSW 7 126,066,750 (GRCm39) utr 3 prime probably benign
R9624:Sh2b1 UTSW 7 126,066,744 (GRCm39) utr 3 prime probably benign
R9624:Sh2b1 UTSW 7 126,066,742 (GRCm39) utr 3 prime probably benign
Z1176:Sh2b1 UTSW 7 126,066,903 (GRCm39) missense probably benign 0.23
Z1177:Sh2b1 UTSW 7 126,070,295 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATTCAGGCAGGGCAACTCCAG -3'
(R):5'- CAGCAGCAGGATGAGTATATGTCGG -3'

Sequencing Primer
(F):5'- CAACTCCAGGCTGTCTGTG -3'
(R):5'- AGTATATGTCGGGGGCTTTGAG -3'
Posted On 2013-04-11