Incidental Mutation 'R0130:Sh2b1'
ID21612
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene NameSH2B adaptor protein 1
SynonymsIrip, SH2-Bb, SH2-B, Sh2bpsm1
MMRRC Submission 038415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R0130 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location126466994-126475424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126471448 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 360 (D360E)
Ref Sequence ENSEMBL: ENSMUSP00000146121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206643] [ENSMUST00000206664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032978
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733
AA Change: D360E

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205340
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205440
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205497
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205733
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205889
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206515
Predicted Effect probably benign
Transcript: ENSMUST00000206643
Predicted Effect possibly damaging
Transcript: ENSMUST00000206664
AA Change: D360E

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.5241 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126472364 missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126468926 missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126468513 missense possibly damaging 0.59
R7694:Sh2b1 UTSW 7 126467757 missense probably benign 0.03
R7801:Sh2b1 UTSW 7 126471292 missense probably benign 0.15
R8005:Sh2b1 UTSW 7 126469307 missense possibly damaging 0.82
R8353:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8356:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8453:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467600 nonsense probably null
R8683:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R8921:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8921:Sh2b1 UTSW 7 126467581
R8922:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
Z1176:Sh2b1 UTSW 7 126467731 missense probably benign 0.23
Z1177:Sh2b1 UTSW 7 126471123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATTCAGGCAGGGCAACTCCAG -3'
(R):5'- CAGCAGCAGGATGAGTATATGTCGG -3'

Sequencing Primer
(F):5'- CAACTCCAGGCTGTCTGTG -3'
(R):5'- AGTATATGTCGGGGGCTTTGAG -3'
Posted On2013-04-11