Incidental Mutation 'R0388:Ntng2'
ID 216130
Institutional Source Beutler Lab
Gene Symbol Ntng2
Ensembl Gene ENSMUSG00000035513
Gene Name netrin G2
Synonyms Lmnt2, 2610016D08Rik
MMRRC Submission 038594-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R0388 (G1)
Quality Score 66
Status Validated
Chromosome 2
Chromosomal Location 29084738-29138111 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 29097438 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 341 (P341R)
Ref Sequence ENSEMBL: ENSMUSP00000139034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048455] [ENSMUST00000071201] [ENSMUST00000091153] [ENSMUST00000102873] [ENSMUST00000177689] [ENSMUST00000183583]
AlphaFold Q8R4F1
Predicted Effect probably damaging
Transcript: ENSMUST00000048455
AA Change: P341R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035468
Gene: ENSMUSG00000035513
AA Change: P341R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 372 385 N/A INTRINSIC
EGF_Lam 413 466 5.28e-5 SMART
EGF_Lam 469 511 4.12e-7 SMART
EGF 515 547 2.26e-4 SMART
low complexity region 574 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071201
AA Change: P341R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071190
Gene: ENSMUSG00000035513
AA Change: P341R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 346 9.19e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091153
AA Change: P341R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088688
Gene: ENSMUSG00000035513
AA Change: P341R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 388 441 5.28e-5 SMART
EGF_Lam 444 486 4.12e-7 SMART
EGF 490 522 2.26e-4 SMART
low complexity region 549 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102873
AA Change: P341R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099937
Gene: ENSMUSG00000035513
AA Change: P341R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147897
Predicted Effect probably damaging
Transcript: ENSMUST00000177689
AA Change: P341R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136659
Gene: ENSMUSG00000035513
AA Change: P341R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183583
AA Change: P341R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139034
Gene: ENSMUSG00000035513
AA Change: P341R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 345 368 N/A INTRINSIC
Meta Mutation Damage Score 0.4524 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a subclass of the netrin family called netrin-G proteins. Unlike classic netrins, which act as diffusible chemoattractants, netrin-Gs are glycosylphosphatidylinositol-anchored membrane proteins that interact with specific transmembrane proteins. In mouse, this gene is preferentially expressed in the cerebral cortex, habenular nucleus and superior colliculus. Knockout mutant mice display a lack of behavioral startle in response to acoustic stimuli. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an absence of startle reflex and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,516,347 (GRCm39) K678R probably damaging Het
Adgrg6 A G 10: 14,326,402 (GRCm39) I410T probably benign Het
Afap1l2 A C 19: 56,905,674 (GRCm39) probably benign Het
Aox1 T C 1: 58,393,565 (GRCm39) Y1242H probably damaging Het
Apoo-ps T C 13: 107,551,173 (GRCm39) noncoding transcript Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Cdh3 C A 8: 107,265,761 (GRCm39) T268K probably damaging Het
Chd5 T A 4: 152,456,101 (GRCm39) H923Q probably damaging Het
Chd7 T C 4: 8,854,560 (GRCm39) V1967A probably benign Het
Cntn3 T C 6: 102,254,277 (GRCm39) M222V probably damaging Het
Dcaf17 A G 2: 70,908,915 (GRCm39) K277R probably benign Het
Dmbt1 T C 7: 130,697,779 (GRCm39) probably benign Het
Dmpk T A 7: 18,818,002 (GRCm39) probably benign Het
Dzank1 A T 2: 144,318,026 (GRCm39) L714Q possibly damaging Het
Efcab3 A G 11: 105,000,227 (GRCm39) D272G possibly damaging Het
Erbb2 G C 11: 98,318,177 (GRCm39) R471P possibly damaging Het
Esf1 T A 2: 139,962,791 (GRCm39) Y760F possibly damaging Het
Fanci C A 7: 79,089,378 (GRCm39) T938K probably benign Het
Gnai3 A G 3: 108,023,073 (GRCm39) probably benign Het
Hspg2 T A 4: 137,238,469 (GRCm39) C319S probably damaging Het
Il12a T A 3: 68,602,520 (GRCm39) probably null Het
Inpp4a A G 1: 37,435,241 (GRCm39) D837G probably damaging Het
Kcnj5 T A 9: 32,229,159 (GRCm39) E13V probably damaging Het
Kcnq3 T A 15: 65,871,887 (GRCm39) Y594F probably benign Het
Kif16b T C 2: 142,582,857 (GRCm39) E556G probably damaging Het
Kif28 T C 1: 179,567,654 (GRCm39) I39V possibly damaging Het
Lgi2 T C 5: 52,711,891 (GRCm39) E143G probably damaging Het
Mast1 T G 8: 85,642,166 (GRCm39) I1063L probably benign Het
Med12l T C 3: 59,000,925 (GRCm39) probably benign Het
Mmp19 G T 10: 128,634,752 (GRCm39) R456L probably benign Het
Mon1b T A 8: 114,365,710 (GRCm39) V346E probably damaging Het
Mpv17l A T 16: 13,758,863 (GRCm39) I96L probably benign Het
Mrgpra9 A T 7: 46,902,542 (GRCm39) M1K probably null Het
Mycbp2 A T 14: 103,394,103 (GRCm39) H2819Q probably benign Het
Nav1 A C 1: 135,376,655 (GRCm39) probably benign Het
Neurl4 T C 11: 69,802,559 (GRCm39) probably benign Het
Oas1d A T 5: 121,055,091 (GRCm39) Y221F probably damaging Het
Or1j19 C A 2: 36,676,874 (GRCm39) D112E probably benign Het
Or1l4 A C 2: 37,092,196 (GRCm39) probably null Het
Or5al6 A G 2: 85,976,974 (GRCm39) Y35H probably damaging Het
Osbpl8 A G 10: 111,108,143 (GRCm39) M380V probably benign Het
Pank1 T C 19: 34,799,106 (GRCm39) probably benign Het
Parn T C 16: 13,472,340 (GRCm39) D169G possibly damaging Het
Pknox1 T A 17: 31,822,166 (GRCm39) I311N probably damaging Het
Pprc1 T C 19: 46,051,214 (GRCm39) V248A possibly damaging Het
Prkcq T C 2: 11,259,045 (GRCm39) C322R probably benign Het
Ptpn13 T A 5: 103,702,928 (GRCm39) I1298N probably benign Het
Rab11fip3 A G 17: 26,288,046 (GRCm39) S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sass6 C A 3: 116,400,957 (GRCm39) probably benign Het
Shroom3 G A 5: 93,099,152 (GRCm39) G1463D probably benign Het
Slc35d1 A T 4: 103,042,084 (GRCm39) Y249* probably null Het
Slc9a3 C T 13: 74,269,655 (GRCm39) P8S unknown Het
Slc9a9 T A 9: 94,821,616 (GRCm39) probably null Het
Sting1 A G 18: 35,868,164 (GRCm39) probably null Het
Syne2 T A 12: 76,033,749 (GRCm39) M3666K probably benign Het
Synpo2 A G 3: 122,873,546 (GRCm39) V1140A probably benign Het
Thada A G 17: 84,538,524 (GRCm39) F1495L probably benign Het
Timeless A G 10: 128,077,294 (GRCm39) probably null Het
Tlr6 G T 5: 65,112,548 (GRCm39) H120N possibly damaging Het
Tns3 T C 11: 8,395,703 (GRCm39) I1234V probably benign Het
Ttll9 A G 2: 152,842,099 (GRCm39) S318G probably benign Het
Vps13c T C 9: 67,830,197 (GRCm39) probably benign Het
Zfp933 T C 4: 147,910,899 (GRCm39) I232M probably benign Het
Zfyve27 T C 19: 42,178,024 (GRCm39) S382P probably damaging Het
Other mutations in Ntng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0526:Ntng2 UTSW 2 29,087,074 (GRCm39) missense probably damaging 1.00
R1835:Ntng2 UTSW 2 29,087,069 (GRCm39) nonsense probably null
R1961:Ntng2 UTSW 2 29,087,110 (GRCm39) missense probably damaging 1.00
R2507:Ntng2 UTSW 2 29,097,531 (GRCm39) missense probably damaging 1.00
R2920:Ntng2 UTSW 2 29,094,223 (GRCm39) missense probably benign
R3944:Ntng2 UTSW 2 29,094,289 (GRCm39) missense probably benign 0.02
R3954:Ntng2 UTSW 2 29,097,547 (GRCm39) missense probably damaging 0.97
R6235:Ntng2 UTSW 2 29,117,991 (GRCm39) missense probably damaging 1.00
R6742:Ntng2 UTSW 2 29,090,940 (GRCm39) missense probably benign
R6751:Ntng2 UTSW 2 29,118,055 (GRCm39) missense possibly damaging 0.89
R6774:Ntng2 UTSW 2 29,087,102 (GRCm39) missense probably damaging 1.00
R6907:Ntng2 UTSW 2 29,118,218 (GRCm39) missense probably damaging 1.00
R6964:Ntng2 UTSW 2 29,087,041 (GRCm39) missense probably benign 0.02
R6995:Ntng2 UTSW 2 29,087,080 (GRCm39) missense probably damaging 1.00
R7214:Ntng2 UTSW 2 29,117,732 (GRCm39) missense probably damaging 0.99
R7249:Ntng2 UTSW 2 29,118,004 (GRCm39) missense probably benign 0.03
R7825:Ntng2 UTSW 2 29,094,090 (GRCm39) missense probably benign 0.00
R8337:Ntng2 UTSW 2 29,138,050 (GRCm39) start codon destroyed probably null 0.88
R8775:Ntng2 UTSW 2 29,117,976 (GRCm39) missense possibly damaging 0.63
R8775-TAIL:Ntng2 UTSW 2 29,117,976 (GRCm39) missense possibly damaging 0.63
R9058:Ntng2 UTSW 2 29,094,202 (GRCm39) missense probably benign
R9203:Ntng2 UTSW 2 29,084,998 (GRCm39) nonsense probably null
R9319:Ntng2 UTSW 2 29,091,121 (GRCm39) intron probably benign
R9411:Ntng2 UTSW 2 29,138,048 (GRCm39) missense probably damaging 1.00
R9480:Ntng2 UTSW 2 29,137,997 (GRCm39) missense probably damaging 0.99
R9512:Ntng2 UTSW 2 29,117,969 (GRCm39) missense possibly damaging 0.89
X0023:Ntng2 UTSW 2 29,087,075 (GRCm39) nonsense probably null
X0028:Ntng2 UTSW 2 29,087,161 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCCCTGCTCAGAATGAAGAAGGATG -3'
(R):5'- GGTCTCCTCAGGTGTAAGTGCAAC -3'

Sequencing Primer
(F):5'- CCTGCAACTAGGGCTGAGAG -3'
(R):5'- GCAGGTGCAAGAAGAACTTC -3'
Posted On 2014-07-25