Incidental Mutation 'R0671:Mroh2a'
ID 216137
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Name maestro heat-like repeat family member 2A
Synonyms ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804
MMRRC Submission 038856-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R0671 (G1)
Quality Score 33
Status Validated
Chromosome 1
Chromosomal Location 88154713-88190011 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 88170142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 685 (A685D)
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
AlphaFold D3Z750
Predicted Effect possibly damaging
Transcript: ENSMUST00000061013
AA Change: A688D

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: A688D

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113130
AA Change: A685D

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: A685D

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142632
Meta Mutation Damage Score 0.2131 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,729,637 (GRCm39) probably benign Het
A530064D06Rik G A 17: 48,473,824 (GRCm39) T31I probably benign Het
Abca17 A G 17: 24,500,223 (GRCm39) F1323L probably benign Het
Abcf3 T A 16: 20,369,237 (GRCm39) N206K probably damaging Het
Adam10 A G 9: 70,673,223 (GRCm39) probably benign Het
Adamtsl3 A T 7: 82,172,390 (GRCm39) Q451L probably damaging Het
Adgrl3 T A 5: 81,708,752 (GRCm39) I413N probably benign Het
Asb18 G T 1: 89,920,893 (GRCm39) A128E probably damaging Het
Atf7ip2 T C 16: 10,059,743 (GRCm39) S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 (GRCm39) C15F possibly damaging Het
Bahcc1 A G 11: 120,178,146 (GRCm39) E2235G probably damaging Het
Blnk G T 19: 40,926,111 (GRCm39) S330* probably null Het
Bpnt1 T G 1: 185,088,808 (GRCm39) N319K probably benign Het
Brip1 G A 11: 86,043,493 (GRCm39) T357I possibly damaging Het
Cadm1 T A 9: 47,725,104 (GRCm39) D288E probably benign Het
Calcoco2 A G 11: 95,998,354 (GRCm39) V23A probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc154 G T 17: 25,386,259 (GRCm39) probably benign Het
Cdk12 T C 11: 98,120,935 (GRCm39) probably benign Het
Clec4a3 A G 6: 122,930,993 (GRCm39) probably null Het
Cpne2 T A 8: 95,274,970 (GRCm39) probably benign Het
Cyfip1 T C 7: 55,573,710 (GRCm39) probably null Het
Cyp26c1 A G 19: 37,675,009 (GRCm39) H110R probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Defb43 T A 14: 63,249,287 (GRCm39) V10D probably damaging Het
Dhx36 G A 3: 62,401,162 (GRCm39) S368L possibly damaging Het
Dock6 G A 9: 21,715,923 (GRCm39) probably benign Het
Elp2 T C 18: 24,745,499 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,249 (GRCm39) L453P probably damaging Het
Eml6 A T 11: 29,755,065 (GRCm39) D903E probably benign Het
Ep300 T C 15: 81,500,335 (GRCm39) probably benign Het
Ep400 G A 5: 110,836,062 (GRCm39) T1899M unknown Het
Fancg A G 4: 43,002,998 (GRCm39) S620P probably benign Het
Fbxo42 G A 4: 140,922,550 (GRCm39) V239M probably damaging Het
Fermt2 T C 14: 45,706,776 (GRCm39) D340G probably benign Het
Filip1 A T 9: 79,726,672 (GRCm39) V649E probably damaging Het
Fut8 G A 12: 77,521,791 (GRCm39) E477K probably damaging Het
Gbp3 G A 3: 142,271,151 (GRCm39) G185D probably benign Het
Gclc G T 9: 77,694,080 (GRCm39) D345Y probably damaging Het
Gfus A G 15: 75,800,807 (GRCm39) V27A possibly damaging Het
Gkn2 A G 6: 87,352,800 (GRCm39) D43G possibly damaging Het
Gnptab A G 10: 88,279,166 (GRCm39) probably benign Het
Greb1l C T 18: 10,474,303 (GRCm39) T206I probably damaging Het
Grk4 A G 5: 34,905,611 (GRCm39) N452S probably benign Het
Hcn2 G C 10: 79,570,066 (GRCm39) probably null Het
Hpn T C 7: 30,808,585 (GRCm39) K76E possibly damaging Het
Hspg2 A G 4: 137,280,591 (GRCm39) D3268G probably damaging Het
Immt A T 6: 71,848,541 (GRCm39) Q467L possibly damaging Het
Kalrn T C 16: 33,936,778 (GRCm39) S1636G probably benign Het
Kcnh8 T A 17: 53,285,141 (GRCm39) L1037* probably null Het
Klhl33 T C 14: 51,129,851 (GRCm39) T548A probably damaging Het
Klri2 T C 6: 129,717,171 (GRCm39) I71V probably benign Het
Kmt2c A T 5: 25,609,363 (GRCm39) C254S probably damaging Het
Lama3 T C 18: 12,610,647 (GRCm39) I1170T possibly damaging Het
Med12l A G 3: 59,172,350 (GRCm39) Q1702R probably damaging Het
Mga A T 2: 119,750,391 (GRCm39) probably null Het
Mis18a A T 16: 90,517,561 (GRCm39) I172K possibly damaging Het
Mrgpre T C 7: 143,335,254 (GRCm39) D83G probably benign Het
Mrpl39 T C 16: 84,531,282 (GRCm39) probably benign Het
Mrrf C T 2: 36,043,710 (GRCm39) A149V probably benign Het
Mycbp2 A T 14: 103,432,024 (GRCm39) M2338K possibly damaging Het
Myo18b T C 5: 112,840,632 (GRCm39) Q2387R probably benign Het
N4bp2 T C 5: 65,964,780 (GRCm39) I943T probably damaging Het
Ncapd3 T A 9: 26,998,773 (GRCm39) N1254K probably benign Het
Ncoa1 A T 12: 4,299,758 (GRCm39) probably null Het
Ncor2 C T 5: 125,126,451 (GRCm39) A136T probably benign Het
Opa1 T C 16: 29,421,025 (GRCm39) probably benign Het
Or13a25 A G 7: 140,247,590 (GRCm39) D123G probably damaging Het
Or5p59 C A 7: 107,703,363 (GRCm39) Y282* probably null Het
Or8b39 T A 9: 37,996,423 (GRCm39) M97K possibly damaging Het
Or9e1 T A 11: 58,732,681 (GRCm39) I247N possibly damaging Het
Pcdhb4 T C 18: 37,440,795 (GRCm39) M35T probably benign Het
Per3 T C 4: 151,113,288 (GRCm39) I347V probably benign Het
Pex13 G A 11: 23,615,831 (GRCm39) P5L possibly damaging Het
Phkb T A 8: 86,602,322 (GRCm39) W38R probably damaging Het
Plekhf1 A T 7: 37,920,826 (GRCm39) D247E probably benign Het
Plxnb2 A G 15: 89,042,184 (GRCm39) S1607P probably benign Het
Plxnc1 T A 10: 94,635,194 (GRCm39) H1344L possibly damaging Het
Potefam1 A C 2: 111,034,482 (GRCm39) V350G possibly damaging Het
Ptk7 T G 17: 46,901,238 (GRCm39) N196H possibly damaging Het
Rab27a G T 9: 72,982,715 (GRCm39) D7Y probably damaging Het
Rars2 T A 4: 34,630,505 (GRCm39) C82* probably null Het
Rccd1 A T 7: 79,969,965 (GRCm39) probably benign Het
Riiad1 T C 3: 94,379,546 (GRCm39) I56V possibly damaging Het
Rnase4 A G 14: 51,342,507 (GRCm39) E77G probably damaging Het
Rnf126 A T 10: 79,597,441 (GRCm39) I157N possibly damaging Het
Rnf207 T C 4: 152,391,925 (GRCm39) R623G probably benign Het
Rpusd1 T G 17: 25,947,498 (GRCm39) F62V possibly damaging Het
Rxfp1 T C 3: 79,570,600 (GRCm39) probably null Het
Scfd1 A T 12: 51,459,411 (GRCm39) Q324L probably benign Het
Skint3 G T 4: 112,112,974 (GRCm39) E195* probably null Het
Slc7a10 A T 7: 34,896,758 (GRCm39) T165S probably benign Het
Smagp A G 15: 100,519,733 (GRCm39) I97T probably damaging Het
Sostdc1 A G 12: 36,367,340 (GRCm39) H172R probably damaging Het
Spast A G 17: 74,646,446 (GRCm39) probably benign Het
Sspo G T 6: 48,467,325 (GRCm39) probably benign Het
Ston2 C T 12: 91,707,240 (GRCm39) probably null Het
Tas2r103 T G 6: 133,013,313 (GRCm39) E251A probably benign Het
Tbc1d2b A T 9: 90,104,558 (GRCm39) probably benign Het
Telo2 G A 17: 25,332,139 (GRCm39) P143L probably benign Het
Tgfbi A T 13: 56,786,539 (GRCm39) Y674F probably null Het
Tha1 T A 11: 117,763,983 (GRCm39) probably benign Het
Timp4 T A 6: 115,226,814 (GRCm39) S110C probably damaging Het
Tlr6 T C 5: 65,111,935 (GRCm39) K324R probably benign Het
Tnip3 A G 6: 65,574,347 (GRCm39) E137G probably damaging Het
Top6bl A G 19: 4,676,216 (GRCm39) S639P probably damaging Het
Trak1 T C 9: 121,278,021 (GRCm39) probably null Het
Trim47 A G 11: 115,999,178 (GRCm39) S233P probably benign Het
Tspoap1 A T 11: 87,653,635 (GRCm39) E155V probably damaging Het
Uggt1 A T 1: 36,194,209 (GRCm39) L1343Q probably damaging Het
Utp14b T C 1: 78,642,452 (GRCm39) S117P probably benign Het
Vmn1r124 A T 7: 20,994,436 (GRCm39) V36D probably damaging Het
Wdr27 T C 17: 15,148,658 (GRCm39) T112A probably benign Het
Wdr90 T C 17: 26,065,367 (GRCm39) T1630A probably benign Het
Zfp352 A G 4: 90,112,156 (GRCm39) T99A probably benign Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88,172,692 (GRCm39) missense probably benign 0.03
IGL00990:Mroh2a APN 1 88,161,842 (GRCm39) missense possibly damaging 0.76
IGL00990:Mroh2a APN 1 88,158,468 (GRCm39) missense probably damaging 0.99
IGL03097:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R0032:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0068:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0139:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0374:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R0536:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0548:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0583:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0613:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0657:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0675:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0675:Mroh2a UTSW 1 88,156,102 (GRCm39) missense probably damaging 0.99
R0689:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0689:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0735:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0845:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0853:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0959:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R0960:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1028:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1268:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1281:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
R1414:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1439:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88,169,353 (GRCm39) missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88,160,075 (GRCm39) splice site probably benign
R1442:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R1686:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1686:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1780:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1846:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1899:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1958:Mroh2a UTSW 1 88,165,213 (GRCm39) nonsense probably null
R2122:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2248:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2306:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R2869:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2870:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2871:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3408:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3608:Mroh2a UTSW 1 88,172,717 (GRCm39) missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3937:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4022:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4133:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88,187,311 (GRCm39) missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4625:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4665:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4701:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R4701:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4771:Mroh2a UTSW 1 88,179,087 (GRCm39) missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4839:Mroh2a UTSW 1 88,165,666 (GRCm39) missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R5007:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5031:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5062:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5301:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5367:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5446:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5506:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5561:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5615:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5825:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R5891:Mroh2a UTSW 1 88,169,337 (GRCm39) missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5928:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R6004:Mroh2a UTSW 1 88,176,377 (GRCm39) missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88,158,390 (GRCm39) missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6074:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R6091:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6127:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6234:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6234:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6244:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6464:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6575:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6809:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R6819:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R8350:Mroh2a UTSW 1 88,171,805 (GRCm39) splice site probably null
R9414:Mroh2a UTSW 1 88,179,096 (GRCm39) missense probably benign 0.26
RF024:Mroh2a UTSW 1 88,170,207 (GRCm39) missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88,154,813 (GRCm39) start gained probably benign
V8831:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
X0027:Mroh2a UTSW 1 88,176,335 (GRCm39) missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0028:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0033:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,160,014 (GRCm39) missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0039:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,377 (GRCm39) missense probably benign 0.25
X0057:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0063:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1188:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Z1190:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1192:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCCCAGGTTTGTGGGTAGGAAC -3'
(R):5'- AAAGCACAGGATGACGCCCTTCAG -3'

Sequencing Primer
(F):5'- TAGGAAAGGATTTGGCCTTCAC -3'
(R):5'- ACGCCCTTCAGGGAAGC -3'
Posted On 2014-07-25