Mutagenetix > Incidental Mutations

Incidental Mutation 'R0130:Atp7b'

21614

Institutional Source

Beutler Lab

Gene Symbol

Atp7b

Ensembl Gene

ENSMUSG00000006567

Gene Name

ATPase, Cu++ transporting, beta polypeptide

Synonyms

Atp7a, WND, Wilson protein

MMRRC Submission

038415-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.653) question?

Stock #

R0130 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

21992785-22060305 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 22028172 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 205 (E205K)

Ref Sequence

ENSEMBL: ENSMUSP00000106366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]

AlphaFold

Q64446

Predicted Effect

probably benign
Transcript: ENSMUST00000006742
AA Change: E217K

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: E217K

Domain	Start	End	E-Value	Type
Pfam:HMA	71	132	8.8e-14	PFAM
Pfam:HMA	156	217	6.6e-13	PFAM
Pfam:HMA	271	329	7.4e-13	PFAM
Pfam:HMA	364	425	1.1e-10	PFAM
Pfam:HMA	493	554	2.3e-14	PFAM
Pfam:HMA	569	630	3.1e-15	PFAM
transmembrane domain	656	675	N/A	INTRINSIC
Pfam:E1-E2_ATPase	770	1018	3.3e-60	PFAM
Pfam:Hydrolase	1023	1276	1.3e-67	PFAM
Pfam:HAD	1026	1273	4.6e-10	PFAM
Pfam:Hydrolase_3	1243	1308	5.1e-7	PFAM
transmembrane domain	1322	1344	N/A	INTRINSIC
low complexity region	1353	1370	N/A	INTRINSIC
low complexity region	1418	1437	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110738
AA Change: E205K

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: E205K

Domain	Start	End	E-Value	Type
Pfam:HMA	59	120	1.2e-13	PFAM
Pfam:HMA	144	205	9.7e-12	PFAM
PDB:2AW0\|A	259	314	6e-6	PDB
Pfam:HMA	378	439	1.6e-13	PFAM
Pfam:HMA	454	515	1.5e-15	PFAM
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:E1-E2_ATPase	656	904	4.6e-50	PFAM
Pfam:Hydrolase	908	1161	6.6e-76	PFAM
Pfam:HAD	911	1158	1.5e-15	PFAM
Pfam:Hydrolase_3	1128	1193	8.5e-7	PFAM
transmembrane domain	1207	1229	N/A	INTRINSIC
low complexity region	1238	1255	N/A	INTRINSIC
low complexity region	1303	1322	N/A	INTRINSIC

Meta Mutation Damage Score

0.0905

Coding Region Coverage

1x: 99.0%
3x: 97.7%
10x: 93.4%
20x: 80.2%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	A	T	17: 84,686,666	Y37F	probably damaging	Het
Ablim2	G	A	5: 35,809,176		probably benign	Het
Anxa9	A	G	3: 95,302,422	S129P	probably benign	Het
Apol7c	A	G	15: 77,526,362	I128T	possibly damaging	Het
Arfgef2	T	G	2: 166,835,719	I88S	probably damaging	Het
Arfip2	A	G	7: 105,638,998		probably benign	Het
Atp5j2	A	T	5: 145,188,182		probably benign	Het
Atp8b5	T	A	4: 43,369,715		probably null	Het
Cd22	A	G	7: 30,869,964	Y402H	possibly damaging	Het
Cd248	A	G	19: 5,069,962	T613A	probably benign	Het
Cdcp2	C	T	4: 107,106,707		probably benign	Het
Cenpc1	A	T	5: 86,046,546	D120E	probably benign	Het
Chd3	T	A	11: 69,359,830	H691L	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cped1	T	A	6: 22,121,039	Y373N	probably benign	Het
Cr2	A	T	1: 195,166,231	V328D	probably damaging	Het
Ctnnd2	A	T	15: 30,921,913	E895V	probably damaging	Het
D630045J12Rik	A	T	6: 38,149,771		probably benign	Het
Dcdc2a	A	T	13: 25,187,672		probably benign	Het
Dync1h1	C	A	12: 110,618,674	T837K	probably benign	Het
Eif2ak3	C	A	6: 70,881,732		probably benign	Het
Epb41l5	A	C	1: 119,549,902	V705G	possibly damaging	Het
Fat2	T	A	11: 55,252,118	M4302L	probably benign	Het
Flnb	T	C	14: 7,901,951	V938A	probably damaging	Het
Frmd4a	T	C	2: 4,604,092	Y928H	probably damaging	Het
Fyn	C	T	10: 39,511,982	T78M	probably benign	Het
Gdap2	A	G	3: 100,201,995	T443A	probably damaging	Het
Gde1	A	T	7: 118,695,060	F63L	probably benign	Het
Gjc3	A	G	5: 137,957,940	S28P	probably benign	Het
Gm10250	G	A	15: 5,120,991		probably null	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Klhl23	T	C	2: 69,833,966	V553A	probably damaging	Het
Lman2l	G	T	1: 36,424,864	S171*	probably null	Het
Lrp1b	T	C	2: 41,511,508	D378G	probably damaging	Het
Map3k11	T	C	19: 5,690,815	L190P	probably damaging	Het
Mki67	T	A	7: 135,696,459	Q2282L	probably damaging	Het
Mthfd2	T	A	6: 83,309,008	I272F	probably damaging	Het
Myom1	A	T	17: 71,045,755	D358V	probably damaging	Het
Nebl	T	A	2: 17,393,023	Q487H	possibly damaging	Het
Nebl	T	C	2: 17,390,926		probably benign	Het
Nlrp2	T	A	7: 5,322,418	N14Y	possibly damaging	Het
Olfr1090	T	C	2: 86,753,887	M284V	probably benign	Het
Olfr304	T	C	7: 86,386,306	Y118C	probably damaging	Het
Olfr339	T	A	2: 36,422,287	D296E	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr992	T	A	2: 85,399,961	S191C	probably damaging	Het
Paxip1	C	T	5: 27,744,185		probably benign	Het
Pclo	A	G	5: 14,679,797		probably benign	Het
Pld2	T	G	11: 70,554,348	N591K	probably benign	Het
Plekha7	A	G	7: 116,170,704	M276T	probably damaging	Het
Prss39	T	A	1: 34,502,200		probably benign	Het
Prtg	A	G	9: 72,809,716	Y113C	probably damaging	Het
Rab38	T	A	7: 88,450,541	I88N	probably damaging	Het
Rbfox2	A	G	15: 77,091,857		probably benign	Het
Samd5	A	G	10: 9,674,939	W9R	probably damaging	Het
Sec14l1	A	T	11: 117,156,407	K637I	possibly damaging	Het
Sh2b1	A	T	7: 126,471,448	D360E	possibly damaging	Het
Sh3bp4	A	G	1: 89,145,314	N628S	possibly damaging	Het
Sim1	A	T	10: 50,907,961	I104F	probably damaging	Het
Smcp	T	A	3: 92,584,520	T7S	unknown	Het
Sp4	A	G	12: 118,300,816		probably benign	Het
Tectb	G	T	19: 55,181,961	K81N	probably damaging	Het
Thbs4	G	T	13: 92,754,410	H850N	probably benign	Het
Tiam1	T	C	16: 89,897,754	M272V	probably benign	Het
Trav13-3	T	A	14: 53,729,776		noncoding transcript	Het
Ubap2l	A	T	3: 90,021,373	S478T	possibly damaging	Het
Vmn2r85	A	G	10: 130,419,185		probably benign	Het

Other mutations in Atp7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Atp7b	APN	8	22011098	missense	possibly damaging	0.91
IGL00981:Atp7b	APN	8	22027527	splice site	probably null
IGL01600:Atp7b	APN	8	22027525	splice site	probably null
IGL01713:Atp7b	APN	8	22028573	missense	probably damaging	1.00
IGL01778:Atp7b	APN	8	21994828	missense	probably benign	0.42
IGL01926:Atp7b	APN	8	22011781	missense	probably damaging	0.98
IGL02312:Atp7b	APN	8	21994770	missense	probably damaging	0.99
IGL02562:Atp7b	APN	8	22028085	missense	probably benign
IGL02573:Atp7b	APN	8	22022470	missense	probably benign	0.00
IGL02603:Atp7b	APN	8	21994776	missense	possibly damaging	0.88
IGL02622:Atp7b	APN	8	22028438	missense	possibly damaging	0.69
IGL02721:Atp7b	APN	8	22022477	missense	probably benign	0.00
IGL03145:Atp7b	APN	8	22018143	missense	probably damaging	1.00
daffodil	UTSW	8	21998266	missense	probably damaging	1.00
menace	UTSW	8	22022365	missense	probably damaging	0.97
PIT4131001:Atp7b	UTSW	8	21994656	missense	probably damaging	1.00
R0023:Atp7b	UTSW	8	22011073	missense	probably damaging	1.00
R0046:Atp7b	UTSW	8	22059995	missense	probably benign	0.00
R0128:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0325:Atp7b	UTSW	8	22028451	missense	probably benign	0.22
R0412:Atp7b	UTSW	8	21995659	splice site	probably null
R0856:Atp7b	UTSW	8	21997631	missense	probably damaging	1.00
R0906:Atp7b	UTSW	8	22027826	missense	probably benign
R0989:Atp7b	UTSW	8	22028694	missense	possibly damaging	0.51
R1377:Atp7b	UTSW	8	22011785	missense	probably benign	0.17
R1517:Atp7b	UTSW	8	21997358	missense	probably damaging	1.00
R1521:Atp7b	UTSW	8	22027673	missense	probably damaging	0.96
R1529:Atp7b	UTSW	8	22028724	missense	possibly damaging	0.87
R1691:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R1743:Atp7b	UTSW	8	22006387	missense	probably damaging	1.00
R1815:Atp7b	UTSW	8	22011651	missense	possibly damaging	0.80
R2008:Atp7b	UTSW	8	22027980	missense	probably damaging	1.00
R2133:Atp7b	UTSW	8	22011077	missense	probably damaging	1.00
R2155:Atp7b	UTSW	8	22013584	missense	possibly damaging	0.69
R2182:Atp7b	UTSW	8	22014547	missense	probably damaging	0.99
R2256:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2257:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2274:Atp7b	UTSW	8	22020832	missense	probably benign	0.20
R2475:Atp7b	UTSW	8	21994776	missense	possibly damaging	0.88
R2906:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R2907:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R3421:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3422:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3688:Atp7b	UTSW	8	22004230	missense	probably damaging	1.00
R3945:Atp7b	UTSW	8	22020864	missense	probably benign	0.02
R4235:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R4700:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4701:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4877:Atp7b	UTSW	8	22028601	missense	probably damaging	0.98
R4962:Atp7b	UTSW	8	22020885	missense	probably damaging	1.00
R5009:Atp7b	UTSW	8	22027698	missense	possibly damaging	0.88
R5016:Atp7b	UTSW	8	22015869	splice site	probably null
R5038:Atp7b	UTSW	8	22028456	missense	possibly damaging	0.67
R5438:Atp7b	UTSW	8	22014554	missense	probably benign
R5467:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R5468:Atp7b	UTSW	8	22059970	critical splice donor site	probably null
R5512:Atp7b	UTSW	8	22012739	missense	probably benign	0.20
R5563:Atp7b	UTSW	8	22028714	missense	possibly damaging	0.82
R5751:Atp7b	UTSW	8	22018128	missense	probably damaging	1.00
R5773:Atp7b	UTSW	8	22027863	missense	probably benign
R5941:Atp7b	UTSW	8	21997496	missense	probably damaging	0.98
R6227:Atp7b	UTSW	8	22020825	missense	possibly damaging	0.63
R6265:Atp7b	UTSW	8	22015927	nonsense	probably null
R6290:Atp7b	UTSW	8	22020820	missense	probably damaging	1.00
R6368:Atp7b	UTSW	8	22020755	splice site	probably null
R6647:Atp7b	UTSW	8	22028478	missense	probably damaging	1.00
R6788:Atp7b	UTSW	8	22004375	missense	probably benign	0.37
R6830:Atp7b	UTSW	8	22022365	missense	probably damaging	0.97
R6886:Atp7b	UTSW	8	22028690	missense	probably benign	0.01
R6928:Atp7b	UTSW	8	21994812	missense	probably benign
R6965:Atp7b	UTSW	8	22028085	missense	probably benign
R7203:Atp7b	UTSW	8	21997335	missense	probably damaging	1.00
R7222:Atp7b	UTSW	8	22022378	nonsense	probably null
R7344:Atp7b	UTSW	8	21997499	missense	probably damaging	1.00
R7384:Atp7b	UTSW	8	22022315	missense	probably benign	0.01
R7449:Atp7b	UTSW	8	22011849	missense	probably damaging	0.98
R7451:Atp7b	UTSW	8	22014684	nonsense	probably null
R7607:Atp7b	UTSW	8	22011506	missense	probably damaging	1.00
R8140:Atp7b	UTSW	8	22028560	missense	probably damaging	1.00
R8160:Atp7b	UTSW	8	21997559	missense	probably damaging	0.98
R8349:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8421:Atp7b	UTSW	8	22028471	missense	probably benign	0.01
R8449:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8749:Atp7b	UTSW	8	22028318	missense	probably damaging	0.96
R8989:Atp7b	UTSW	8	22020895	missense	probably benign	0.06
R9210:Atp7b	UTSW	8	21997390	missense	probably damaging	1.00
R9353:Atp7b	UTSW	8	22027874	missense	possibly damaging	0.78
Z1176:Atp7b	UTSW	8	22028714	missense	probably benign	0.07
Z1177:Atp7b	UTSW	8	21994877	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATGGATGTTTGCTGCACACCTTTC -3'
(R):5'- TGTCAGTCCTGTGTCAGCTCTATCG -3'

Sequencing Primer
(F):5'- CATGTCTTCGATAGGCTGAACAG -3'
(R):5'- TCAGCTCTATCGAGGGCAAG -3'

Posted On

2013-04-11