Incidental Mutation 'R0671:Rnf207'
ID 216144
Institutional Source Beutler Lab
Gene Symbol Rnf207
Ensembl Gene ENSMUSG00000058498
Gene Name ring finger protein 207
MMRRC Submission 038856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R0671 (G1)
Quality Score 45
Status Validated
Chromosome 4
Chromosomal Location 152307019-152318993 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 152307468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 623 (R623G)
Ref Sequence ENSEMBL: ENSMUSP00000075540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048892] [ENSMUST00000076183] [ENSMUST00000151372] [ENSMUST00000170820]
AlphaFold Q3V3A7
Predicted Effect probably benign
Transcript: ENSMUST00000048892
SMART Domains Protein: ENSMUSP00000043390
Gene: ENSMUSG00000039662

transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 42 59 N/A INTRINSIC
transmembrane domain 66 85 N/A INTRINSIC
Pfam:PEMT 158 263 2.6e-11 PFAM
Pfam:ICMT 163 257 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076183
AA Change: R623G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075540
Gene: ENSMUSG00000058498
AA Change: R623G

RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 3.6e-11 PFAM
Pfam:DUF3583 204 378 1.2e-10 PFAM
coiled coil region 422 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135837
Predicted Effect probably benign
Transcript: ENSMUST00000151372
SMART Domains Protein: ENSMUSP00000133950
Gene: ENSMUSG00000039662

transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 42 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170820
SMART Domains Protein: ENSMUSP00000129400
Gene: ENSMUSG00000058498

RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 1e-11 PFAM
low complexity region 236 242 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 387 426 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,003,008 probably benign Het
4930430A15Rik A C 2: 111,204,137 V350G possibly damaging Het
A530064D06Rik G A 17: 48,166,656 T31I probably benign Het
Abca17 A G 17: 24,281,249 F1323L probably benign Het
Abcf3 T A 16: 20,550,487 N206K probably damaging Het
Adam10 A G 9: 70,765,941 probably benign Het
Adamtsl3 A T 7: 82,523,182 Q451L probably damaging Het
Adgrl3 T A 5: 81,560,905 I413N probably benign Het
Asb18 G T 1: 89,993,171 A128E probably damaging Het
Atf7ip2 T C 16: 10,241,879 S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 C15F possibly damaging Het
Bahcc1 A G 11: 120,287,320 E2235G probably damaging Het
Blnk G T 19: 40,937,667 S330* probably null Het
Bpnt1 T G 1: 185,356,611 N319K probably benign Het
Brip1 G A 11: 86,152,667 T357I possibly damaging Het
Cadm1 T A 9: 47,813,806 D288E probably benign Het
Calcoco2 A G 11: 96,107,528 V23A probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc154 G T 17: 25,167,285 probably benign Het
Cdk12 T C 11: 98,230,109 probably benign Het
Clec4a3 A G 6: 122,954,034 probably null Het
Cpne2 T A 8: 94,548,342 probably benign Het
Cyfip1 T C 7: 55,923,962 probably null Het
Cyp26c1 A G 19: 37,686,561 H110R probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Defb43 T A 14: 63,011,838 V10D probably damaging Het
Dhx36 G A 3: 62,493,741 S368L possibly damaging Het
Dock6 G A 9: 21,804,627 probably benign Het
Elp2 T C 18: 24,612,442 probably benign Het
Emilin3 A G 2: 160,908,329 L453P probably damaging Het
Eml6 A T 11: 29,805,065 D903E probably benign Het
Ep300 T C 15: 81,616,134 probably benign Het
Ep400 G A 5: 110,688,196 T1899M unknown Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Fbxo42 G A 4: 141,195,239 V239M probably damaging Het
Fermt2 T C 14: 45,469,319 D340G probably benign Het
Filip1 A T 9: 79,819,390 V649E probably damaging Het
Fut8 G A 12: 77,475,017 E477K probably damaging Het
Gbp3 G A 3: 142,565,390 G185D probably benign Het
Gclc G T 9: 77,786,798 D345Y probably damaging Het
Gkn2 A G 6: 87,375,818 D43G possibly damaging Het
Gm960 A G 19: 4,626,188 S639P probably damaging Het
Gnptab A G 10: 88,443,304 probably benign Het
Greb1l C T 18: 10,474,303 T206I probably damaging Het
Grk4 A G 5: 34,748,267 N452S probably benign Het
Hcn2 G C 10: 79,734,232 probably null Het
Hpn T C 7: 31,109,160 K76E possibly damaging Het
Hspg2 A G 4: 137,553,280 D3268G probably damaging Het
Immt A T 6: 71,871,557 Q467L possibly damaging Het
Kalrn T C 16: 34,116,408 S1636G probably benign Het
Kcnh8 T A 17: 52,978,113 L1037* probably null Het
Klhl33 T C 14: 50,892,394 T548A probably damaging Het
Klri2 T C 6: 129,740,208 I71V probably benign Het
Kmt2c A T 5: 25,404,365 C254S probably damaging Het
Lama3 T C 18: 12,477,590 I1170T possibly damaging Het
Med12l A G 3: 59,264,929 Q1702R probably damaging Het
Mga A T 2: 119,919,910 probably null Het
Mis18a A T 16: 90,720,673 I172K possibly damaging Het
Mrgpre T C 7: 143,781,517 D83G probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mrpl39 T C 16: 84,734,394 probably benign Het
Mrrf C T 2: 36,153,698 A149V probably benign Het
Mycbp2 A T 14: 103,194,588 M2338K possibly damaging Het
Myo18b T C 5: 112,692,766 Q2387R probably benign Het
N4bp2 T C 5: 65,807,437 I943T probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Ncoa1 A T 12: 4,249,758 probably null Het
Ncor2 C T 5: 125,049,387 A136T probably benign Het
Olfr311 T A 11: 58,841,855 I247N possibly damaging Het
Olfr483 C A 7: 108,104,156 Y282* probably null Het
Olfr539 A G 7: 140,667,677 D123G probably damaging Het
Olfr887 T A 9: 38,085,127 M97K possibly damaging Het
Opa1 T C 16: 29,602,207 probably benign Het
Pcdhb4 T C 18: 37,307,742 M35T probably benign Het
Per3 T C 4: 151,028,831 I347V probably benign Het
Pex13 G A 11: 23,665,831 P5L possibly damaging Het
Phkb T A 8: 85,875,693 W38R probably damaging Het
Plekhf1 A T 7: 38,221,402 D247E probably benign Het
Plxnb2 A G 15: 89,157,981 S1607P probably benign Het
Plxnc1 T A 10: 94,799,332 H1344L possibly damaging Het
Ptk7 T G 17: 46,590,312 N196H possibly damaging Het
Rab27a G T 9: 73,075,433 D7Y probably damaging Het
Rars2 T A 4: 34,630,505 C82* probably null Het
Rccd1 A T 7: 80,320,217 probably benign Het
Riiad1 T C 3: 94,472,239 I56V possibly damaging Het
Rnase4 A G 14: 51,105,050 E77G probably damaging Het
Rnf126 A T 10: 79,761,607 I157N possibly damaging Het
Rpusd1 T G 17: 25,728,524 F62V possibly damaging Het
Rxfp1 T C 3: 79,663,293 probably null Het
Scfd1 A T 12: 51,412,628 Q324L probably benign Het
Skint3 G T 4: 112,255,777 E195* probably null Het
Slc7a10 A T 7: 35,197,333 T165S probably benign Het
Smagp A G 15: 100,621,852 I97T probably damaging Het
Sostdc1 A G 12: 36,317,341 H172R probably damaging Het
Spast A G 17: 74,339,451 probably benign Het
Sspo G T 6: 48,490,391 probably benign Het
Ston2 C T 12: 91,740,466 probably null Het
Tas2r103 T G 6: 133,036,350 E251A probably benign Het
Tbc1d2b A T 9: 90,222,505 probably benign Het
Telo2 G A 17: 25,113,165 P143L probably benign Het
Tgfbi A T 13: 56,638,726 Y674F probably null Het
Tha1 T A 11: 117,873,157 probably benign Het
Timp4 T A 6: 115,249,853 S110C probably damaging Het
Tlr6 T C 5: 64,954,592 K324R probably benign Het
Tnip3 A G 6: 65,597,363 E137G probably damaging Het
Trak1 T C 9: 121,448,955 probably null Het
Trim47 A G 11: 116,108,352 S233P probably benign Het
Tspoap1 A T 11: 87,762,809 E155V probably damaging Het
Tsta3 A G 15: 75,928,958 V27A possibly damaging Het
Uggt1 A T 1: 36,155,128 L1343Q probably damaging Het
Utp14b T C 1: 78,664,735 S117P probably benign Het
Vmn1r124 A T 7: 21,260,511 V36D probably damaging Het
Wdr27 T C 17: 14,928,396 T112A probably benign Het
Wdr90 T C 17: 25,846,393 T1630A probably benign Het
Zfp352 A G 4: 90,223,919 T99A probably benign Het
Other mutations in Rnf207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Rnf207 APN 4 152318261 splice site probably benign
IGL02325:Rnf207 APN 4 152311780 missense probably damaging 0.97
IGL02451:Rnf207 APN 4 152312412 missense probably benign 0.25
felonius UTSW 4 152311780 missense probably damaging 0.98
perjury UTSW 4 152313215 missense probably benign 0.00
R0311:Rnf207 UTSW 4 152315779 missense probably damaging 1.00
R0462:Rnf207 UTSW 4 152313372 missense possibly damaging 0.78
R0845:Rnf207 UTSW 4 152312064 splice site probably benign
R1544:Rnf207 UTSW 4 152313871 splice site probably benign
R1667:Rnf207 UTSW 4 152313215 missense probably benign 0.00
R4052:Rnf207 UTSW 4 152311437 missense probably benign 0.41
R4335:Rnf207 UTSW 4 152315605 splice site probably benign
R4649:Rnf207 UTSW 4 152312155 missense probably benign 0.06
R5033:Rnf207 UTSW 4 152313209 missense probably benign 0.00
R5268:Rnf207 UTSW 4 152313889 missense probably damaging 1.00
R5603:Rnf207 UTSW 4 152312394 missense probably damaging 1.00
R5938:Rnf207 UTSW 4 152317928 intron probably benign
R6147:Rnf207 UTSW 4 152315655 missense probably damaging 1.00
R6181:Rnf207 UTSW 4 152308848 missense probably benign 0.00
R6866:Rnf207 UTSW 4 152312532 missense possibly damaging 0.81
R7166:Rnf207 UTSW 4 152311780 missense probably damaging 0.98
R7177:Rnf207 UTSW 4 152312177 missense probably benign 0.43
R7354:Rnf207 UTSW 4 152314091 missense probably damaging 0.96
R7893:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
R8200:Rnf207 UTSW 4 152314035 critical splice donor site probably null
R8789:Rnf207 UTSW 4 152307467 missense probably benign 0.04
R9520:Rnf207 UTSW 4 152311777 missense probably damaging 1.00
X0026:Rnf207 UTSW 4 152316042 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttcatagcagtagcaacattacag -3'
Posted On 2014-07-25