Incidental Mutation 'R0206:Csgalnact2'
ID216175
Institutional Source Beutler Lab
Gene Symbol Csgalnact2
Ensembl Gene ENSMUSG00000042042
Gene Namechondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms4632415D10Rik, Galnact2
MMRRC Submission 038459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0206 (G1)
Quality Score65
Status Validated
Chromosome6
Chromosomal Location118107452-118139140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 118114386 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 197 (Q197P)
Ref Sequence ENSEMBL: ENSMUSP00000116371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049344] [ENSMUST00000136265]
Predicted Effect probably benign
Transcript: ENSMUST00000049344
AA Change: Q439P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000039819
Gene: ENSMUSG00000042042
AA Change: Q439P

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:CHGN 53 516 3e-83 PFAM
Pfam:Glyco_tranf_2_2 273 477 4.1e-8 PFAM
Pfam:Glyco_transf_7C 413 489 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125531
Predicted Effect probably benign
Transcript: ENSMUST00000136265
AA Change: Q197P

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116371
Gene: ENSMUSG00000042042
AA Change: Q197P

DomainStartEndE-ValueType
Pfam:CHGN 2 223 5.8e-45 PFAM
Pfam:Glyco_tranf_2_2 31 223 6.5e-9 PFAM
Pfam:Glyco_transf_7C 170 223 1.2e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. The encoded protein is involved in elongation during chondroitin sulfate synthesis. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome X. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,282,662 C5R probably damaging Het
4930430F08Rik T A 10: 100,586,194 K69* probably null Het
A530064D06Rik G A 17: 48,163,318 T165I probably benign Het
A830010M20Rik A G 5: 107,505,040 T304A probably benign Het
Acsl5 A G 19: 55,280,569 K221E probably benign Het
Adam26a A C 8: 43,570,418 F12V possibly damaging Het
Adgrb2 T C 4: 129,992,559 L164P probably damaging Het
Aldh1l1 T C 6: 90,569,866 F384L possibly damaging Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdca3 C T 6: 124,832,551 probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Cit A T 5: 115,994,030 N1782Y possibly damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Ddt A G 10: 75,772,885 M1T probably null Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Gabra6 C T 11: 42,317,079 W188* probably null Het
Gnptab A T 10: 88,439,510 H1111L probably damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Inpp5k T C 11: 75,631,143 I15T probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Kctd8 A T 5: 69,341,165 V46E probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Me3 A T 7: 89,849,660 T483S probably benign Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mvk C T 5: 114,458,974 T334M probably damaging Het
Mxra8 T A 4: 155,842,596 I329N probably damaging Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Myom1 T C 17: 71,037,297 S266P probably damaging Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr308 T C 7: 86,321,646 Y102C probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Olfr690 A T 7: 105,329,883 M103K possibly damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Pomgnt1 T C 4: 116,158,560 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rmdn2 T A 17: 79,650,287 probably benign Het
Ryr2 A G 13: 11,676,251 probably benign Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Slc1a3 A G 15: 8,708,556 probably benign Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Snx33 G A 9: 56,926,224 S187L probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tinag A G 9: 76,999,852 I367T probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ube4b T C 4: 149,398,637 H58R probably benign Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Usp28 A G 9: 49,028,269 Y275C probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Vps13c A G 9: 67,939,162 probably benign Het
Vwf T C 6: 125,637,456 F1100S probably damaging Het
Zfp318 G T 17: 46,399,019 R556L probably benign Het
Zkscan1 T A 5: 138,101,186 C391S probably damaging Het
Other mutations in Csgalnact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Csgalnact2 APN 6 118126272 start codon destroyed probably null 0.88
IGL00955:Csgalnact2 APN 6 118129264 missense probably damaging 1.00
IGL01396:Csgalnact2 APN 6 118126327 missense probably damaging 1.00
IGL01757:Csgalnact2 APN 6 118129346 missense probably damaging 1.00
IGL02687:Csgalnact2 APN 6 118124415 critical splice acceptor site probably null
IGL02833:Csgalnact2 APN 6 118129268 missense probably damaging 1.00
IGL02837:Csgalnact2 UTSW 6 118124403 missense probably benign 0.10
R0761:Csgalnact2 UTSW 6 118126112 splice site probably benign
R1201:Csgalnact2 UTSW 6 118114432 missense probably damaging 0.98
R2106:Csgalnact2 UTSW 6 118109129 nonsense probably null
R3773:Csgalnact2 UTSW 6 118126219 missense probably benign 0.17
R3900:Csgalnact2 UTSW 6 118121014 missense probably damaging 1.00
R5618:Csgalnact2 UTSW 6 118126316 missense probably damaging 0.99
R5682:Csgalnact2 UTSW 6 118120992 missense probably damaging 1.00
R5744:Csgalnact2 UTSW 6 118126236 missense probably damaging 1.00
R5895:Csgalnact2 UTSW 6 118129254 nonsense probably null
R7819:Csgalnact2 UTSW 6 118121089 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTGGCCTTTTGCATAGCACTCAAAC -3'
(R):5'- CCTCAGCTTCAAAGCAGTACAGGAC -3'

Sequencing Primer
(F):5'- GTGGCTGTAACACCTACGAC -3'
(R):5'- CTCATGCAGATTAGGATAGTCGC -3'
Posted On2014-07-28