Mutagenetix > Incidental Mutation

Incidental Mutation 'R0194:Cfap54'

216184

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

038453-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R0194 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 93034662 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000170065] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020200

SMART Domains

Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	643	3e-298	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168110

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168617

SMART Domains

Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	148	4.3e-22	PFAM
Pfam:DUF4486	145	595	1.6e-244	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170065

Predicted Effect

probably benign
Transcript: ENSMUST00000212902

Predicted Effect

probably benign
Transcript: ENSMUST00000220280

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 91.4%
20x: 70.1%

Validation Efficiency

91% (439/482)

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	T	A	4: 35,197,207	D122V	probably damaging	Het
4930553M12Rik	T	A	4: 88,868,243	D46V	unknown	Het
Abcb9	A	G	5: 124,077,295	V461A	probably damaging	Het
Ackr4	T	A	9: 104,099,480	L89F	probably benign	Het
Acsf2	T	C	11: 94,561,370	T449A	probably benign	Het
Acsl4	C	G	X: 142,333,718	G489R	probably damaging	Het
Actl6a	T	A	3: 32,725,320	I399N	probably damaging	Het
Adamts19	G	A	18: 59,011,148	C934Y	probably null	Het
Adsl	A	G	15: 80,961,360	E40G	possibly damaging	Het
AI481877	T	A	4: 59,066,534		probably benign	Het
Alppl2	T	G	1: 87,088,743	D203A	probably damaging	Het
Asb10	C	A	5: 24,537,932	A268S	probably benign	Het
Atp9a	T	C	2: 168,643,885	S832G	probably benign	Het
Bckdha	A	T	7: 25,631,450	I297N	probably damaging	Het
Blm	G	A	7: 80,464,946		probably benign	Het
Cacna1h	A	G	17: 25,380,924		probably benign	Het
Camsap2	G	A	1: 136,292,948	Q298*	probably null	Het
Ccdc38	A	T	10: 93,565,912	K145*	probably null	Het
Cfap45	C	T	1: 172,541,327	T434M	probably benign	Het
Clcn6	G	A	4: 148,012,756	P618L	probably damaging	Het
Copg1	T	C	6: 87,904,197		probably benign	Het
Dctd	T	A	8: 48,112,078	N79K	probably benign	Het
Dgkq	A	G	5: 108,654,644		probably benign	Het
Dntt	A	T	19: 41,038,970	T159S	possibly damaging	Het
Doc2g	G	A	19: 4,003,656	R29Q	probably benign	Het
Dsg3	A	G	18: 20,540,142	T957A	probably damaging	Het
Eif3c	T	A	7: 126,558,623		probably benign	Het
Ephb3	T	A	16: 21,218,109	D107E	probably benign	Het
Esrrb	A	T	12: 86,470,481	D108V	probably damaging	Het
Exo1	A	G	1: 175,892,030	K214E	probably damaging	Het
Fam186a	G	A	15: 99,941,763	T2200I	possibly damaging	Het
Fam227a	C	T	15: 79,640,669	W194*	probably null	Het
Foxn4	A	G	5: 114,259,748		probably null	Het
Gabbr2	T	C	4: 46,787,565	K366R	possibly damaging	Het
Garem2	T	A	5: 30,113,930	V130E	probably damaging	Het
Grin2b	A	G	6: 135,779,305	F474S	probably damaging	Het
H2-M10.6	G	T	17: 36,814,042	V284F	probably damaging	Het
Helz2	C	A	2: 181,232,759	G1981C	probably damaging	Het
Hivep1	G	T	13: 42,155,435	V384F	probably damaging	Het
Hmox1	A	G	8: 75,097,108	T135A	probably damaging	Het
Hpse	T	C	5: 100,719,512	D28G	probably benign	Het
Itm2b	G	T	14: 73,364,618	D213E	probably benign	Het
Jakmip1	T	A	5: 37,134,283	M692K	possibly damaging	Het
Kdm3a	T	C	6: 71,624,594	Q151R	probably null	Het
Limch1	C	A	5: 66,999,273	A517E	probably benign	Het
Lrit1	T	A	14: 37,061,720	L335Q	probably damaging	Het
Lrrc37a	A	G	11: 103,499,790	V1603A	possibly damaging	Het
Mbtps1	T	A	8: 119,535,369	N347I	probably damaging	Het
Mier1	A	T	4: 103,139,519		probably null	Het
Mt2	A	T	8: 94,172,848	M1L	probably damaging	Het
Mug1	A	T	6: 121,840,107	E45V	probably damaging	Het
Mybphl	A	G	3: 108,374,168	K67E	probably benign	Het
Myh4	A	G	11: 67,252,336	K1030R	probably damaging	Het
Myl3	T	A	9: 110,769,121	D176E	probably benign	Het
Ncapg2	A	G	12: 116,420,683		probably null	Het
Ndor1	T	C	2: 25,248,706		probably null	Het
Nedd4	T	G	9: 72,670,053	N53K	possibly damaging	Het
Nek11	C	A	9: 105,392,952	A24S	probably benign	Het
Nudt19	G	T	7: 35,551,514	P267T	probably benign	Het
Olfml2b	T	C	1: 170,681,115	M514T	possibly damaging	Het
Olfr304	A	T	7: 86,386,374	C95*	probably null	Het
Olfr424	A	T	1: 174,136,761	T6S	probably benign	Het
Olfr556	A	G	7: 102,670,199	D93G	probably benign	Het
Olfr699	C	A	7: 106,790,823	M59I	probably benign	Het
P3h1	T	A	4: 119,237,952	F302Y	probably damaging	Het
Pappa2	T	A	1: 158,765,101		probably benign	Het
Pex2	A	C	3: 5,561,364	H128Q	probably benign	Het
Phf11d	A	C	14: 59,352,731	L214R	probably damaging	Het
Plcg2	G	A	8: 117,573,397		probably benign	Het
Ppargc1b	A	C	18: 61,307,945	L634R	possibly damaging	Het
Prune1	A	T	3: 95,262,360	I177N	probably damaging	Het
Puf60	T	C	15: 76,070,485	D496G	probably damaging	Het
Rasl11b	A	G	5: 74,196,163		probably null	Het
Sdr42e1	A	T	8: 117,663,109	F264L	probably damaging	Het
Sec24b	A	T	3: 129,984,165		probably null	Het
Sgta	G	T	10: 81,051,059	P79T	probably benign	Het
Shisa9	C	T	16: 11,984,954	T125M	probably damaging	Het
Slc12a2	A	G	18: 57,930,211	D921G	probably damaging	Het
Slc13a5	C	T	11: 72,245,233	V494I	probably benign	Het
Slc13a5	T	A	11: 72,262,130	I42L	possibly damaging	Het
Spire2	G	A	8: 123,363,011		probably benign	Het
Sptbn4	G	A	7: 27,404,911	R962C	probably benign	Het
St8sia5	G	A	18: 77,254,724	V377I	probably benign	Het
Stag2	T	G	X: 42,206,137		probably benign	Het
Syne1	C	A	10: 5,424,311	M165I	probably benign	Het
Synm	C	A	7: 67,734,924	V997L	probably damaging	Het
Tacc1	A	G	8: 25,182,376	S279P	probably benign	Het
Tbc1d10a	T	C	11: 4,212,901		probably null	Het
Tbc1d19	A	G	5: 53,860,156	T302A	probably damaging	Het
Tecpr1	A	C	5: 144,218,517	N74K	probably damaging	Het
Tmem120a	T	C	5: 135,742,398	E28G	possibly damaging	Het
Tnfrsf1b	A	T	4: 145,224,812	I186N	probably benign	Het
Trim55	A	G	3: 19,661,861	D195G	probably benign	Het
Trpm3	G	T	19: 22,715,356		probably null	Het
Ttc39a	T	A	4: 109,444,179	S571T	probably benign	Het
Vwf	T	G	6: 125,643,297	I1646S	probably benign	Het
Wbp2nl	T	C	15: 82,314,282	F340S	possibly damaging	Het
Yeats2	T	C	16: 20,152,969	M1T	probably null	Het
Zfp236	T	A	18: 82,656,987	E460V	probably damaging	Het
Zfp277	G	A	12: 40,378,877		probably benign	Het
Zfp975	T	A	7: 42,662,492	K232N	probably benign	Het
Zxdc	T	C	6: 90,372,537		probably benign	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5256:Cfap54	UTSW	10	93045023	splice site	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCCTTGTCCACTCTCAAACTG -3'
(R):5'- AAACACCTGCCTACTTGGCTGAC -3'

Sequencing Primer
(F):5'- TGTCCACTCTCAAACTGTAGAGC -3'
(R):5'- CTAGAAAACGTTGCCTCTTTTTGTG -3'

Posted On

2014-07-28