Incidental Mutation 'R0534:Mrpl54'
ID216211
Institutional Source Beutler Lab
Gene Symbol Mrpl54
Ensembl Gene ENSMUSG00000034932
Gene Namemitochondrial ribosomal protein L54
Synonyms0610008M19Rik, D10Sut1e
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R0534 (G1)
Quality Score30
Status Validated
Chromosome10
Chromosomal Location81264713-81266934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81266853 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 13 (W13L)
Ref Sequence ENSEMBL: ENSMUSP00000039951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046114] [ENSMUST00000057798] [ENSMUST00000105328] [ENSMUST00000117488] [ENSMUST00000119547] [ENSMUST00000120265] [ENSMUST00000121205] [ENSMUST00000128576] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000220297] [ENSMUST00000219460]
Predicted Effect probably damaging
Transcript: ENSMUST00000046114
AA Change: W13L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039951
Gene: ENSMUSG00000034932
AA Change: W13L

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Ribosomal_L37 60 103 4.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057798
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105328
SMART Domains Protein: ENSMUSP00000100965
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117488
SMART Domains Protein: ENSMUSP00000113221
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 49 107 1.37e-5 SMART
SH2 118 200 4.87e-31 SMART
TyrKc 233 476 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119547
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120265
SMART Domains Protein: ENSMUSP00000113666
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121205
SMART Domains Protein: ENSMUSP00000113043
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128576
SMART Domains Protein: ENSMUSP00000122445
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 1.55e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217754
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219919
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably benign
Transcript: ENSMUST00000220297
Predicted Effect probably benign
Transcript: ENSMUST00000219460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219294
Meta Mutation Damage Score 0.1695 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Mrpl54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Mrpl54 APN 10 81265649 critical splice donor site probably null
R0855:Mrpl54 UTSW 10 81266925 unclassified probably benign
R1480:Mrpl54 UTSW 10 81265655 missense probably benign 0.04
R2198:Mrpl54 UTSW 10 81265741 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCGTGACACCCAGCC -3'
(R):5'- TTCTTTGAACGGTCGATAGCTACAGAAG -3'

Sequencing Primer
(F):5'- TAGCACGCACCGTTTGG -3'
(R):5'- AGTTAAAATTAGTCGTTAGTCGGGC -3'
Posted On2014-07-31