Incidental Mutation 'R0534:Mrpl54'
ID 216211
Institutional Source Beutler Lab
Gene Symbol Mrpl54
Ensembl Gene ENSMUSG00000034932
Gene Name mitochondrial ribosomal protein L54
Synonyms 0610008M19Rik, D10Sut1e
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R0534 (G1)
Quality Score 30
Status Validated
Chromosome 10
Chromosomal Location 81100556-81102760 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 81102687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 13 (W13L)
Ref Sequence ENSEMBL: ENSMUSP00000039951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046114] [ENSMUST00000057798] [ENSMUST00000105328] [ENSMUST00000117488] [ENSMUST00000119547] [ENSMUST00000120265] [ENSMUST00000121205] [ENSMUST00000219304] [ENSMUST00000218742] [ENSMUST00000128576] [ENSMUST00000220297] [ENSMUST00000219460]
AlphaFold Q9CPW3
Predicted Effect probably damaging
Transcript: ENSMUST00000046114
AA Change: W13L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039951
Gene: ENSMUSG00000034932
AA Change: W13L

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Ribosomal_L37 60 103 4.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057798
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105328
SMART Domains Protein: ENSMUSP00000100965
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117488
SMART Domains Protein: ENSMUSP00000113221
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 49 107 1.37e-5 SMART
SH2 118 200 4.87e-31 SMART
TyrKc 233 476 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119547
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120265
SMART Domains Protein: ENSMUSP00000113666
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175040
Predicted Effect probably benign
Transcript: ENSMUST00000121205
SMART Domains Protein: ENSMUSP00000113043
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect probably benign
Transcript: ENSMUST00000128576
SMART Domains Protein: ENSMUSP00000122445
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 1.55e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219919
Predicted Effect probably benign
Transcript: ENSMUST00000220297
Predicted Effect probably benign
Transcript: ENSMUST00000219460
Meta Mutation Damage Score 0.1695 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
E2f4 C A 8: 106,030,851 (GRCm39) F353L probably damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Gtf3c2 A T 5: 31,315,476 (GRCm39) probably benign Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lipe C A 7: 25,087,611 (GRCm39) A150S possibly damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mtcl3 T A 10: 29,056,952 (GRCm39) probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Reln A T 5: 22,152,406 (GRCm39) D2353E probably damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Scnn1g A G 7: 121,366,647 (GRCm39) M615V probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in Mrpl54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Mrpl54 APN 10 81,101,483 (GRCm39) critical splice donor site probably null
R0855:Mrpl54 UTSW 10 81,102,759 (GRCm39) unclassified probably benign
R1480:Mrpl54 UTSW 10 81,101,489 (GRCm39) missense probably benign 0.04
R2198:Mrpl54 UTSW 10 81,101,575 (GRCm39) splice site probably null
R9629:Mrpl54 UTSW 10 81,101,528 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAAGCGTGACACCCAGCC -3'
(R):5'- TTCTTTGAACGGTCGATAGCTACAGAAG -3'

Sequencing Primer
(F):5'- TAGCACGCACCGTTTGG -3'
(R):5'- AGTTAAAATTAGTCGTTAGTCGGGC -3'
Posted On 2014-07-31