Incidental Mutation 'R0534:Fads1'
ID216212
Institutional Source Beutler Lab
Gene Symbol Fads1
Ensembl Gene ENSMUSG00000010663
Gene Namefatty acid desaturase 1
SynonymsA930006B21Rik, 0710001O03Rik
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0534 (G1)
Quality Score39
Status Validated
Chromosome19
Chromosomal Location10182888-10196870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10183065 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 5 (P5L)
Ref Sequence ENSEMBL: ENSMUSP00000010807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807]
Predicted Effect probably benign
Transcript: ENSMUST00000010807
AA Change: P5L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663
AA Change: P5L

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Meta Mutation Damage Score 0.0838 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arachidonic acid deficiency with premature lethality and altered prostaglandin levels. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Fads1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Fads1 APN 19 10183142 missense probably benign 0.02
IGL01536:Fads1 APN 19 10194030 missense probably benign 0.36
IGL02642:Fads1 APN 19 10186421 missense probably damaging 1.00
teewinot UTSW 19 10185727 nonsense probably null
R0023:Fads1 UTSW 19 10186897 splice site probably benign
R0023:Fads1 UTSW 19 10186897 splice site probably benign
R0367:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0464:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0465:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0848:Fads1 UTSW 19 10183065 missense probably benign 0.12
R1456:Fads1 UTSW 19 10185752 missense probably benign 0.06
R1697:Fads1 UTSW 19 10194100 splice site probably benign
R5576:Fads1 UTSW 19 10185874 missense probably benign 0.00
R5640:Fads1 UTSW 19 10186403 missense probably damaging 1.00
R6243:Fads1 UTSW 19 10185727 nonsense probably null
R6379:Fads1 UTSW 19 10183187 missense probably damaging 1.00
R7593:Fads1 UTSW 19 10184997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTCTTTGCTACCCGAGAGAG -3'
(R):5'- CAACCAGCCCTTTGTTTGAGTGTG -3'

Sequencing Primer
(F):5'- ACTCGGCTCAGCCAATG -3'
(R):5'- AGATGCGCCTATTGTCCG -3'
Posted On2014-07-31