Incidental Mutation 'R0612:Pdlim4'
ID 216216
Institutional Source Beutler Lab
Gene Symbol Pdlim4
Ensembl Gene ENSMUSG00000020388
Gene Name PDZ and LIM domain 4
Synonyms Ril
MMRRC Submission 038801-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R0612 (G1)
Quality Score 65
Status Validated
Chromosome 11
Chromosomal Location 54054928-54069014 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54068887 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 16 (R16C)
Ref Sequence ENSEMBL: ENSMUSP00000090797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018755] [ENSMUST00000093109] [ENSMUST00000144477]
AlphaFold P70271
Predicted Effect probably damaging
Transcript: ENSMUST00000018755
AA Change: R16C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018755
Gene: ENSMUSG00000020388
AA Change: R16C

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Pfam:DUF4749 142 230 7.2e-14 PFAM
LIM 254 305 9.75e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093109
AA Change: R16C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090797
Gene: ENSMUSG00000020388
AA Change: R16C

DomainStartEndE-ValueType
PDZ 11 84 1.05e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127271
Predicted Effect probably benign
Transcript: ENSMUST00000144477
SMART Domains Protein: ENSMUSP00000121248
Gene: ENSMUSG00000020388

DomainStartEndE-ValueType
Blast:PDZ 1 25 2e-10 BLAST
SCOP:d1qava_ 1 25 3e-4 SMART
PDB:2V1W|B 1 28 2e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151948
Meta Mutation Damage Score 0.8928 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which may be involved in bone development. Mutations in this gene are associated with susceptibility to osteoporosis. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 probably null Het
Abca15 T C 7: 120,337,255 L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 S30G probably benign Het
Atp9b T C 18: 80,753,956 E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 A112V probably benign Het
Cab39 T C 1: 85,818,515 probably null Het
Cacna2d4 G T 6: 119,281,718 probably benign Het
Capzb C T 4: 139,291,029 S253L probably benign Het
Ccdc174 A G 6: 91,890,892 probably benign Het
Ccdc180 C T 4: 45,927,969 A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 probably benign Het
Cdh8 T C 8: 99,400,914 T22A probably benign Het
Cdk10 T C 8: 123,230,680 V181A probably benign Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cftr A C 6: 18,198,126 T20P probably benign Het
Clstn3 T C 6: 124,449,500 T576A probably damaging Het
Col1a2 G A 6: 4,516,003 V165I unknown Het
Copg2 A T 6: 30,861,469 probably null Het
Cps1 A G 1: 67,139,770 H47R probably benign Het
Cytip T C 2: 58,134,190 D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 E824K probably damaging Het
Dock7 A C 4: 98,989,233 V442G probably benign Het
Dsc1 T G 18: 20,114,516 K14T probably damaging Het
Dync1h1 C T 12: 110,616,496 P371L probably damaging Het
Enah A G 1: 181,906,448 probably benign Het
Fam189a1 C T 7: 64,761,801 V395M probably benign Het
Fastkd1 T C 2: 69,712,383 T27A probably benign Het
Fcho1 A G 8: 71,715,524 L248P probably damaging Het
Fezf1 A T 6: 23,247,029 V268D probably damaging Het
Fgd2 T A 17: 29,378,347 V547E probably benign Het
Flnb T A 14: 7,887,682 probably benign Het
Gabrg3 A G 7: 56,729,706 M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 F1265L probably damaging Het
Git2 A G 5: 114,752,281 S271P probably damaging Het
Gm13103 G T 4: 143,852,088 probably benign Het
Gm14085 T C 2: 122,521,698 M339T probably damaging Het
Gorab T C 1: 163,397,169 D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 T964S possibly damaging Het
Hdac5 A G 11: 102,196,252 V1042A possibly damaging Het
Hoxa2 T A 6: 52,163,560 T149S probably damaging Het
Igsf8 G T 1: 172,319,407 *108L probably null Het
Il1rap C T 16: 26,701,105 T307M possibly damaging Het
Itih2 T C 2: 10,117,394 D232G probably benign Het
Jak3 A G 8: 71,683,377 Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Lrrn2 T C 1: 132,937,728 L177P probably damaging Het
Map4k3 C A 17: 80,602,193 K712N probably damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mmp14 A G 14: 54,440,434 D504G probably damaging Het
Mob1a A G 6: 83,334,158 T120A probably benign Het
Mr1 T A 1: 155,137,690 D47V probably damaging Het
Nacad G T 11: 6,601,382 A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 T153A probably benign Het
Olfr525 T A 7: 140,323,188 M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 T93S probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pde6c T A 19: 38,133,246 C101S probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pet2 G A X: 89,405,366 R386* probably null Het
Pfkp A G 13: 6,605,634 probably null Het
Plcg2 T A 8: 117,573,365 S225T probably benign Het
Pramel1 T C 4: 143,397,531 S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 N92D possibly damaging Het
Ric8b C A 10: 85,001,881 N517K probably damaging Het
Rnf34 G A 5: 122,864,174 R65H probably damaging Het
Rraga C T 4: 86,576,327 R137C probably damaging Het
Scube2 C T 7: 109,804,764 probably benign Het
Spata31d1d T C 13: 59,727,973 I583V probably benign Het
Suox T C 10: 128,670,656 E501G probably benign Het
Susd1 A G 4: 59,390,561 probably benign Het
Tac1 T C 6: 7,555,653 S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 V662M probably damaging Het
Upf2 G T 2: 6,034,098 probably benign Het
Uspl1 A G 5: 149,214,957 E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 C367S probably damaging Het
Vps13b A T 15: 35,623,657 Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Yeats2 T G 16: 20,186,425 V385G probably benign Het
Other mutations in Pdlim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Pdlim4 APN 11 54056304 missense probably benign 0.43
IGL02005:Pdlim4 APN 11 54059984 missense probably benign 0.10
IGL02305:Pdlim4 APN 11 54055933 missense probably damaging 1.00
IGL03073:Pdlim4 APN 11 54063641 missense probably damaging 1.00
BB001:Pdlim4 UTSW 11 54055222 nonsense probably null
BB011:Pdlim4 UTSW 11 54055222 nonsense probably null
R0008:Pdlim4 UTSW 11 54055049 missense probably damaging 1.00
R1646:Pdlim4 UTSW 11 54056254 missense possibly damaging 0.94
R1754:Pdlim4 UTSW 11 54055873 missense possibly damaging 0.82
R2132:Pdlim4 UTSW 11 54063737 missense possibly damaging 0.70
R3037:Pdlim4 UTSW 11 54056257 missense probably benign 0.15
R4210:Pdlim4 UTSW 11 54055918 missense possibly damaging 0.70
R5787:Pdlim4 UTSW 11 54055216 missense probably damaging 1.00
R5969:Pdlim4 UTSW 11 54063656 missense possibly damaging 0.50
R6862:Pdlim4 UTSW 11 54055848 missense probably damaging 1.00
R7924:Pdlim4 UTSW 11 54055222 nonsense probably null
R8927:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R8928:Pdlim4 UTSW 11 54059964 missense probably benign 0.01
R9026:Pdlim4 UTSW 11 54055454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTCACCAAGACCAACACTCTG -3'
(R):5'- TGTCTGAGTTTCCACAGCCTGC -3'

Sequencing Primer
(F):5'- GCTTTCAAGCTTTCGACACG -3'
(R):5'- CAAGCGGACCCTATTCTGG -3'
Posted On 2014-07-31