Incidental Mutation 'R0130:Ctnnd2'
ID21622
Institutional Source Beutler Lab
Gene Symbol Ctnnd2
Ensembl Gene ENSMUSG00000022240
Gene Namecatenin (cadherin associated protein), delta 2
SynonymsCatnd2, neurojugin, Nprap
MMRRC Submission 038415-MU
Accession Numbers

NCBI RefSeq: NM_008729.2; MGI:1195966

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0130 (G1)
Quality Score206
Status Validated (trace)
Chromosome15
Chromosomal Location30172593-31029341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30921913 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 895 (E895V)
Ref Sequence ENSEMBL: ENSMUSP00000154410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081728] [ENSMUST00000226119]
Predicted Effect probably damaging
Transcript: ENSMUST00000081728
AA Change: E920V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080427
Gene: ENSMUSG00000022240
AA Change: E920V

DomainStartEndE-ValueType
coiled coil region 50 84 N/A INTRINSIC
low complexity region 87 97 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
ARM 577 617 1.85e-8 SMART
ARM 621 662 1.15e-9 SMART
ARM 663 720 1.51e1 SMART
ARM 722 769 2.74e1 SMART
ARM 830 871 4.88e0 SMART
ARM 902 942 2.76e-7 SMART
low complexity region 964 973 N/A INTRINSIC
ARM 995 1039 5.64e-4 SMART
low complexity region 1086 1099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226119
AA Change: E895V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype Strain: 3056606
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesive junction associated protein of the armadillo/beta-catenin superfamily and is implicated in brain and eye development and cancer formation. The protein encoded by this gene promotes the disruption of E-cadherin based adherens junction to favor cell spreading upon stimulation by hepatocyte growth factor. This gene is overexpressed in prostate adenocarcinomas and is associated with decreased expression of tumor suppressor E-cadherin in this tissue. This gene resides in a region of the short arm of chromosome 5 that is deleted in Cri du Chat syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal conditioning, spatial learning and coordination behaviors and abnormal long term potentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Ctnnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Ctnnd2 APN 15 30647141 missense possibly damaging 0.73
IGL01612:Ctnnd2 APN 15 31005018 missense probably damaging 1.00
IGL01923:Ctnnd2 APN 15 30480828 missense probably damaging 0.99
IGL02183:Ctnnd2 APN 15 31020740 missense probably damaging 1.00
IGL02186:Ctnnd2 APN 15 30480793 missense probably damaging 0.99
IGL02226:Ctnnd2 APN 15 30847336 missense probably benign 0.01
IGL02307:Ctnnd2 APN 15 30647211 missense possibly damaging 0.86
IGL02407:Ctnnd2 APN 15 30966768 missense probably damaging 1.00
IGL02474:Ctnnd2 APN 15 30669562 missense possibly damaging 0.71
IGL02718:Ctnnd2 APN 15 31027616 missense probably damaging 1.00
IGL03249:Ctnnd2 APN 15 30683236 missense probably benign 0.45
IGL03328:Ctnnd2 APN 15 30921847 splice site probably benign
carpe UTSW 15 30905820 missense probably damaging 1.00
diem UTSW 15 30683347 missense possibly damaging 0.85
P0016:Ctnnd2 UTSW 15 30966938 missense probably benign 0.00
R0408:Ctnnd2 UTSW 15 30634677 missense probably damaging 1.00
R0611:Ctnnd2 UTSW 15 31009084 missense possibly damaging 0.75
R0894:Ctnnd2 UTSW 15 30332155 splice site probably benign
R1112:Ctnnd2 UTSW 15 30921880 missense probably damaging 1.00
R1459:Ctnnd2 UTSW 15 30847299 missense probably damaging 1.00
R1529:Ctnnd2 UTSW 15 30887121 missense possibly damaging 0.91
R1532:Ctnnd2 UTSW 15 30921868 missense probably damaging 1.00
R1701:Ctnnd2 UTSW 15 30921981 missense probably damaging 1.00
R1807:Ctnnd2 UTSW 15 30619871 missense probably damaging 1.00
R1881:Ctnnd2 UTSW 15 31005081 splice site probably benign
R1960:Ctnnd2 UTSW 15 30647111 missense probably damaging 0.96
R2121:Ctnnd2 UTSW 15 30669514 missense probably damaging 1.00
R3839:Ctnnd2 UTSW 15 31009028 splice site probably null
R3967:Ctnnd2 UTSW 15 30646929 missense possibly damaging 0.81
R3980:Ctnnd2 UTSW 15 30669443 missense probably benign 0.14
R4207:Ctnnd2 UTSW 15 30972827 missense probably damaging 0.99
R4279:Ctnnd2 UTSW 15 30905820 missense probably damaging 1.00
R4498:Ctnnd2 UTSW 15 30619874 missense probably damaging 1.00
R4622:Ctnnd2 UTSW 15 30887169 missense probably benign 0.17
R4622:Ctnnd2 UTSW 15 31009113 missense probably benign 0.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4860:Ctnnd2 UTSW 15 30881167 missense probably damaging 1.00
R4979:Ctnnd2 UTSW 15 31009075 missense probably damaging 1.00
R5086:Ctnnd2 UTSW 15 30683347 missense possibly damaging 0.85
R5330:Ctnnd2 UTSW 15 30332115 missense probably damaging 1.00
R5459:Ctnnd2 UTSW 15 30887188 missense probably damaging 1.00
R5595:Ctnnd2 UTSW 15 30669543 missense probably benign 0.07
R5809:Ctnnd2 UTSW 15 30847377 missense probably damaging 1.00
R5987:Ctnnd2 UTSW 15 30683241 missense probably benign
R6245:Ctnnd2 UTSW 15 30905748 missense probably damaging 1.00
R6379:Ctnnd2 UTSW 15 30634698 missense probably damaging 1.00
R6737:Ctnnd2 UTSW 15 30966834 nonsense probably null
R6979:Ctnnd2 UTSW 15 30619230 missense probably damaging 0.99
R7133:Ctnnd2 UTSW 15 30480849 missense possibly damaging 0.47
R7179:Ctnnd2 UTSW 15 30683364 missense possibly damaging 0.95
R7267:Ctnnd2 UTSW 15 30683355 missense probably benign 0.13
R7275:Ctnnd2 UTSW 15 30905709 missense possibly damaging 0.94
R7386:Ctnnd2 UTSW 15 30966768 missense probably damaging 1.00
Z1088:Ctnnd2 UTSW 15 30966813 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGCAGTTCAACCGTTTTGGCTC -3'
(R):5'- AACCAGACTGTTGGTGACTGGAGG -3'

Sequencing Primer
(F):5'- GTTTTGGCTCCTGCAAACAG -3'
(R):5'- TGCAGGCTGTGAGGGAC -3'
Posted On2013-04-11