Incidental Mutation 'R0709:Dars2'
ID 216220
Institutional Source Beutler Lab
Gene Symbol Dars2
Ensembl Gene ENSMUSG00000026709
Gene Name aspartyl-tRNA synthetase 2 (mitochondrial)
Synonyms 5830468K18Rik
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0709 (G1)
Quality Score 51
Status Validated
Chromosome 1
Chromosomal Location 160868171-160898228 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160874498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 397 (E397G)
Ref Sequence ENSEMBL: ENSMUSP00000041851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035430]
AlphaFold Q8BIP0
Predicted Effect probably benign
Transcript: ENSMUST00000035430
AA Change: E397G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041851
Gene: ENSMUSG00000026709
AA Change: E397G

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 65 148 7e-10 PFAM
Pfam:tRNA-synt_2 165 607 1.2e-90 PFAM
Pfam:GAD 355 451 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162654
Meta Mutation Damage Score 0.2102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Dars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Dars2 UTSW 1 160,881,509 (GRCm39) critical splice donor site probably null
R0230:Dars2 UTSW 1 160,890,357 (GRCm39) missense probably benign 0.02
R0537:Dars2 UTSW 1 160,888,318 (GRCm39) missense possibly damaging 0.46
R1365:Dars2 UTSW 1 160,872,564 (GRCm39) nonsense probably null
R1502:Dars2 UTSW 1 160,874,375 (GRCm39) nonsense probably null
R1625:Dars2 UTSW 1 160,881,614 (GRCm39) missense possibly damaging 0.88
R1934:Dars2 UTSW 1 160,890,811 (GRCm39) splice site probably null
R2239:Dars2 UTSW 1 160,890,852 (GRCm39) missense possibly damaging 0.83
R3721:Dars2 UTSW 1 160,890,878 (GRCm39) missense probably benign 0.03
R4308:Dars2 UTSW 1 160,869,291 (GRCm39) missense probably damaging 0.98
R4786:Dars2 UTSW 1 160,888,330 (GRCm39) missense probably damaging 1.00
R4859:Dars2 UTSW 1 160,872,560 (GRCm39) missense probably damaging 0.99
R4903:Dars2 UTSW 1 160,878,941 (GRCm39) missense probably benign 0.06
R5042:Dars2 UTSW 1 160,872,664 (GRCm39) intron probably benign
R5068:Dars2 UTSW 1 160,869,483 (GRCm39) missense probably benign 0.02
R6257:Dars2 UTSW 1 160,869,398 (GRCm39) missense probably damaging 1.00
R7286:Dars2 UTSW 1 160,874,378 (GRCm39) missense possibly damaging 0.85
R7346:Dars2 UTSW 1 160,874,342 (GRCm39) splice site probably null
R7444:Dars2 UTSW 1 160,874,454 (GRCm39) missense possibly damaging 0.94
R7593:Dars2 UTSW 1 160,885,113 (GRCm39) missense probably damaging 1.00
R7845:Dars2 UTSW 1 160,869,318 (GRCm39) missense probably benign 0.00
R8707:Dars2 UTSW 1 160,884,081 (GRCm39) missense probably damaging 1.00
R8916:Dars2 UTSW 1 160,881,552 (GRCm39) missense probably benign 0.20
R9237:Dars2 UTSW 1 160,873,025 (GRCm39) missense probably damaging 1.00
R9277:Dars2 UTSW 1 160,877,527 (GRCm39) missense probably benign 0.07
X0063:Dars2 UTSW 1 160,884,063 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTTTCTCATGTTCCCCAGCAGTCAGT -3'
(R):5'- GGCCTCCCTCAAGTAGGCAAGT -3'

Sequencing Primer
(F):5'- CAGCAGTCAGTAACACTATGTCTTC -3'
(R):5'- ccaaactaaacccttccctcc -3'
Posted On 2014-07-31