Incidental Mutation 'R0709:Nek6'
ID 216221
Institutional Source Beutler Lab
Gene Symbol Nek6
Ensembl Gene ENSMUSG00000026749
Gene Name NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms 1300007C09Rik
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R0709 (G1)
Quality Score 55
Status Validated
Chromosome 2
Chromosomal Location 38401655-38484618 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38447858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 41 (S41T)
Ref Sequence ENSEMBL: ENSMUSP00000120294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054234] [ENSMUST00000112895] [ENSMUST00000112902] [ENSMUST00000151683] [ENSMUST00000156726]
AlphaFold Q9ES70
Predicted Effect probably benign
Transcript: ENSMUST00000054234
AA Change: S41T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049723
Gene: ENSMUSG00000026749
AA Change: S41T

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112895
AA Change: S41T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108516
Gene: ENSMUSG00000026749
AA Change: S41T

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112902
SMART Domains Protein: ENSMUSP00000108523
Gene: ENSMUSG00000026749

DomainStartEndE-ValueType
S_TKc 34 299 3.01e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151683
AA Change: S41T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000156726
AA Change: S41T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114376
Gene: ENSMUSG00000026749
AA Change: S41T

DomainStartEndE-ValueType
Pfam:Pkinase 45 108 6.6e-13 PFAM
Pfam:Pkinase_Tyr 45 108 1.5e-9 PFAM
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: No significant homozygous or heterozygous mutant phenotype was detected in a high throughput screen of a targeted mutation, however these homozygotes exhibit an increased response of the heart to induced stress, with aggravated cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(128) : Targeted(3) Gene trapped(125)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Nek6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03112:Nek6 APN 2 38,450,914 (GRCm39) missense probably damaging 1.00
P0005:Nek6 UTSW 2 38,459,749 (GRCm39) critical splice donor site probably null
R0014:Nek6 UTSW 2 38,448,856 (GRCm39) splice site probably benign
R0674:Nek6 UTSW 2 38,448,916 (GRCm39) missense possibly damaging 0.79
R0835:Nek6 UTSW 2 38,459,643 (GRCm39) missense possibly damaging 0.76
R1548:Nek6 UTSW 2 38,458,907 (GRCm39) missense probably damaging 0.99
R1773:Nek6 UTSW 2 38,472,431 (GRCm39) missense probably benign 0.25
R1901:Nek6 UTSW 2 38,472,458 (GRCm39) missense probably damaging 1.00
R4080:Nek6 UTSW 2 38,440,649 (GRCm39) missense probably damaging 0.99
R4563:Nek6 UTSW 2 38,475,305 (GRCm39) missense probably damaging 1.00
R6207:Nek6 UTSW 2 38,447,846 (GRCm39) missense possibly damaging 0.82
R6865:Nek6 UTSW 2 38,459,678 (GRCm39) missense probably benign
R7339:Nek6 UTSW 2 38,450,977 (GRCm39) missense probably damaging 1.00
R8536:Nek6 UTSW 2 38,404,797 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- ACACTTGTCACACAGTCTGCTTGTC -3'
(R):5'- GGTTCCCATGTCTGAACACAACCC -3'

Sequencing Primer
(F):5'- TAGCAATCTAGCCCTAGGCCTT -3'
(R):5'- ACCCCGTACACAGTAGGTG -3'
Posted On 2014-07-31