Incidental Mutation 'R0709:Nek6'
ID 216221
Institutional Source Beutler Lab
Gene Symbol Nek6
Ensembl Gene ENSMUSG00000026749
Gene Name NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms 1300007C09Rik
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R0709 (G1)
Quality Score 55
Status Validated
Chromosome 2
Chromosomal Location 38511643-38594606 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38557846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 41 (S41T)
Ref Sequence ENSEMBL: ENSMUSP00000120294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054234] [ENSMUST00000112895] [ENSMUST00000112902] [ENSMUST00000151683] [ENSMUST00000156726]
AlphaFold Q9ES70
Predicted Effect probably benign
Transcript: ENSMUST00000054234
AA Change: S41T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049723
Gene: ENSMUSG00000026749
AA Change: S41T

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112895
AA Change: S41T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108516
Gene: ENSMUSG00000026749
AA Change: S41T

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112902
SMART Domains Protein: ENSMUSP00000108523
Gene: ENSMUSG00000026749

DomainStartEndE-ValueType
S_TKc 34 299 3.01e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151683
AA Change: S41T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000156726
AA Change: S41T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114376
Gene: ENSMUSG00000026749
AA Change: S41T

DomainStartEndE-ValueType
Pfam:Pkinase 45 108 6.6e-13 PFAM
Pfam:Pkinase_Tyr 45 108 1.5e-9 PFAM
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype Strain: 5427679
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: No significant homozygous or heterozygous mutant phenotype was detected in a high throughput screen of a targeted mutation, however these homozygotes exhibit an increased response of the heart to induced stress, with aggravated cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(128) : Targeted(3) Gene trapped(125)
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,494 D137V probably damaging Het
Aar2 C T 2: 156,567,010 P378L probably damaging Het
Abcc5 A T 16: 20,376,592 H718Q possibly damaging Het
Ace G T 11: 105,981,538 L319F probably damaging Het
Angpt4 C A 2: 151,934,514 P321T possibly damaging Het
Atrip T C 9: 109,067,103 N282S probably benign Het
AW554918 A C 18: 25,463,654 S525R probably damaging Het
Casc4 T A 2: 121,867,425 V74E probably damaging Het
Ccdc136 T A 6: 29,414,970 I644N possibly damaging Het
Ccdc178 A G 18: 22,067,662 Y413H probably damaging Het
Ccdc7b A G 8: 129,136,646 H223R probably benign Het
Cd109 T C 9: 78,671,978 V634A possibly damaging Het
Col7a1 T A 9: 108,961,548 probably benign Het
Copb2 A T 9: 98,563,167 probably benign Het
Csrnp3 C T 2: 66,022,563 S445L probably damaging Het
Cxcl13 G T 5: 95,958,671 C34F probably damaging Het
Dars2 T C 1: 161,046,928 E397G probably benign Het
Dlg5 C T 14: 24,146,255 V1625M probably damaging Het
Dnah12 T G 14: 26,884,265 probably benign Het
Eif4a1 C A 11: 69,670,252 A76S probably damaging Het
Fam162b T A 10: 51,587,251 I107L probably damaging Het
Fbxo30 G T 10: 11,291,313 C593F possibly damaging Het
Fut9 A G 4: 25,620,359 F152L probably damaging Het
Galnt2 G A 8: 124,343,346 G534D probably benign Het
Gm973 C T 1: 59,558,234 probably benign Het
Gprc5a T A 6: 135,078,950 S132T probably damaging Het
Hk3 G A 13: 55,014,730 R47C probably damaging Het
Hrnr A T 3: 93,332,508 Q3351L unknown Het
Icam1 T A 9: 21,019,127 F92L probably damaging Het
Ifi213 C T 1: 173,589,800 V349I possibly damaging Het
Il12rb2 T C 6: 67,298,904 probably benign Het
Irx3 A G 8: 91,799,420 V487A possibly damaging Het
Kalrn A G 16: 34,035,554 V204A probably damaging Het
Krt16 T C 11: 100,246,454 probably benign Het
Loxhd1 G A 18: 77,404,969 V1369I probably benign Het
Med13 T A 11: 86,319,596 K573N possibly damaging Het
Mnat1 A G 12: 73,188,188 R204G possibly damaging Het
Myt1l A T 12: 29,827,733 D461V unknown Het
Nudt22 T C 19: 6,993,506 E232G probably damaging Het
Numbl C A 7: 27,273,990 F192L probably damaging Het
Olfr1202 C T 2: 88,817,882 T237I probably benign Het
Olfr834 T A 9: 18,988,126 I46K probably damaging Het
P2rx4 T C 5: 122,714,404 V47A probably damaging Het
Phka1 T A X: 102,586,104 I478F probably damaging Het
Pkn2 G A 3: 142,830,520 T200I probably damaging Het
Plcg1 T A 2: 160,751,778 probably null Het
Polg2 C T 11: 106,768,413 G425R probably damaging Het
Ptprm G T 17: 66,944,332 probably null Het
Reg1 G A 6: 78,428,118 R108H possibly damaging Het
Slc19a2 T A 1: 164,256,798 F86I probably damaging Het
Slc26a11 T C 11: 119,374,777 L372P probably damaging Het
Slc2a4 C T 11: 69,946,159 V28M possibly damaging Het
Snap29 A G 16: 17,406,148 N9S probably damaging Het
Snd1 C G 6: 28,545,470 probably benign Het
Sorcs3 G A 19: 48,487,406 A235T probably benign Het
Sp100 T A 1: 85,694,281 N362K probably damaging Het
Sqor A T 2: 122,799,855 I32F probably benign Het
Stx6 C T 1: 155,193,294 R189C probably damaging Het
Tchp T C 5: 114,717,453 I298T probably damaging Het
Themis A G 10: 28,761,574 I225V probably benign Het
Timm50 A T 7: 28,306,941 V245E probably damaging Het
Tnxb A G 17: 34,689,354 E1327G probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Tradd T C 8: 105,260,644 E10G possibly damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Ttn T C 2: 76,899,403 probably benign Het
Ttr A T 18: 20,669,977 probably null Het
Ubp1 A G 9: 113,944,931 Y66C probably damaging Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r104 A T 17: 20,042,904 N98K probably damaging Het
Yipf5 A G 18: 40,207,772 S176P probably benign Het
Zpbp2 C T 11: 98,553,937 T97I probably damaging Het
Other mutations in Nek6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03112:Nek6 APN 2 38560902 missense probably damaging 1.00
P0005:Nek6 UTSW 2 38569737 critical splice donor site probably null
R0014:Nek6 UTSW 2 38558844 splice site probably benign
R0674:Nek6 UTSW 2 38558904 missense possibly damaging 0.79
R0835:Nek6 UTSW 2 38569631 missense possibly damaging 0.76
R1548:Nek6 UTSW 2 38568895 missense probably damaging 0.99
R1773:Nek6 UTSW 2 38582419 missense probably benign 0.25
R1901:Nek6 UTSW 2 38582446 missense probably damaging 1.00
R4080:Nek6 UTSW 2 38550637 missense probably damaging 0.99
R4563:Nek6 UTSW 2 38585293 missense probably damaging 1.00
R6207:Nek6 UTSW 2 38557834 missense possibly damaging 0.82
R6865:Nek6 UTSW 2 38569666 missense probably benign
R7339:Nek6 UTSW 2 38560965 missense probably damaging 1.00
R8536:Nek6 UTSW 2 38514785 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACACTTGTCACACAGTCTGCTTGTC -3'
(R):5'- GGTTCCCATGTCTGAACACAACCC -3'

Sequencing Primer
(F):5'- TAGCAATCTAGCCCTAGGCCTT -3'
(R):5'- ACCCCGTACACAGTAGGTG -3'
Posted On 2014-07-31