Incidental Mutation 'R0709:Snd1'
ID 216224
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Name staphylococcal nuclease and tudor domain containing 1
Synonyms Tudor-SN, p100 co-activator
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R0709 (G1)
Quality Score 63
Status Validated
Chromosome 6
Chromosomal Location 28480332-28935161 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 28545469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201]
AlphaFold Q78PY7
Predicted Effect probably benign
Transcript: ENSMUST00000001460
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167201
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28,512,985 (GRCm39) critical splice donor site probably null
IGL00940:Snd1 APN 6 28,745,174 (GRCm39) intron probably benign
IGL01340:Snd1 APN 6 28,883,368 (GRCm39) missense probably benign
IGL01892:Snd1 APN 6 28,888,123 (GRCm39) critical splice donor site probably null
IGL02063:Snd1 APN 6 28,526,220 (GRCm39) unclassified probably benign
IGL02134:Snd1 APN 6 28,880,278 (GRCm39) missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28,707,149 (GRCm39) intron probably benign
PIT4677001:Snd1 UTSW 6 28,880,295 (GRCm39) missense probably benign 0.01
R0039:Snd1 UTSW 6 28,745,209 (GRCm39) missense probably damaging 1.00
R0053:Snd1 UTSW 6 28,745,334 (GRCm39) intron probably benign
R0053:Snd1 UTSW 6 28,745,334 (GRCm39) intron probably benign
R0463:Snd1 UTSW 6 28,724,955 (GRCm39) missense probably benign 0.00
R0576:Snd1 UTSW 6 28,886,576 (GRCm39) missense probably benign 0.31
R0959:Snd1 UTSW 6 28,884,970 (GRCm39) missense probably benign 0.01
R1698:Snd1 UTSW 6 28,888,252 (GRCm39) nonsense probably null
R1853:Snd1 UTSW 6 28,545,563 (GRCm39) missense probably damaging 1.00
R2059:Snd1 UTSW 6 28,745,206 (GRCm39) missense probably damaging 1.00
R2497:Snd1 UTSW 6 28,888,078 (GRCm39) missense probably benign
R3832:Snd1 UTSW 6 28,531,403 (GRCm39) splice site probably benign
R3833:Snd1 UTSW 6 28,531,403 (GRCm39) splice site probably benign
R4643:Snd1 UTSW 6 28,880,248 (GRCm39) missense probably benign 0.00
R4665:Snd1 UTSW 6 28,707,053 (GRCm39) missense probably damaging 1.00
R4843:Snd1 UTSW 6 28,668,642 (GRCm39) missense probably damaging 1.00
R4884:Snd1 UTSW 6 28,526,911 (GRCm39) missense possibly damaging 0.94
R4959:Snd1 UTSW 6 28,884,250 (GRCm39) nonsense probably null
R4973:Snd1 UTSW 6 28,884,250 (GRCm39) nonsense probably null
R5065:Snd1 UTSW 6 28,888,239 (GRCm39) missense probably damaging 1.00
R5066:Snd1 UTSW 6 28,888,239 (GRCm39) missense probably damaging 1.00
R5067:Snd1 UTSW 6 28,888,239 (GRCm39) missense probably damaging 1.00
R5131:Snd1 UTSW 6 28,885,049 (GRCm39) missense probably damaging 0.99
R5172:Snd1 UTSW 6 28,886,615 (GRCm39) missense possibly damaging 0.91
R5239:Snd1 UTSW 6 28,545,524 (GRCm39) missense probably damaging 1.00
R5313:Snd1 UTSW 6 28,668,600 (GRCm39) missense probably benign 0.15
R5395:Snd1 UTSW 6 28,526,183 (GRCm39) missense probably damaging 0.99
R5938:Snd1 UTSW 6 28,874,858 (GRCm39) critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28,880,233 (GRCm39) missense probably benign 0.00
R6248:Snd1 UTSW 6 28,520,234 (GRCm39) nonsense probably null
R6337:Snd1 UTSW 6 28,888,288 (GRCm39) missense probably damaging 1.00
R6810:Snd1 UTSW 6 28,668,609 (GRCm39) missense probably benign 0.23
R6932:Snd1 UTSW 6 28,626,100 (GRCm39) missense probably benign 0.42
R7469:Snd1 UTSW 6 28,626,126 (GRCm39) missense probably damaging 1.00
R7485:Snd1 UTSW 6 28,531,449 (GRCm39) missense probably benign 0.14
R7571:Snd1 UTSW 6 28,526,202 (GRCm39) missense possibly damaging 0.81
R7866:Snd1 UTSW 6 28,527,724 (GRCm39) missense probably damaging 1.00
R8178:Snd1 UTSW 6 28,874,975 (GRCm39) missense possibly damaging 0.85
R8208:Snd1 UTSW 6 28,526,054 (GRCm39) missense possibly damaging 0.86
R8526:Snd1 UTSW 6 28,745,253 (GRCm39) missense probably benign 0.00
R8848:Snd1 UTSW 6 28,874,962 (GRCm39) missense possibly damaging 0.72
R8854:Snd1 UTSW 6 28,526,968 (GRCm39) missense probably benign 0.02
R9310:Snd1 UTSW 6 28,795,936 (GRCm39) missense probably null 1.00
R9326:Snd1 UTSW 6 28,795,842 (GRCm39) nonsense probably null
R9348:Snd1 UTSW 6 28,745,206 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATCATCTTGTGAATGAAGCAGCTTTT -3'
(R):5'- ACTTGGAGACTGTCAAAGACTTGTCCTT -3'

Sequencing Primer
(F):5'- ATGAAGCAGCTTTTGTTTTACTGAG -3'
(R):5'- ctaaagcacacagcaaagaaac -3'
Posted On 2014-07-31