Incidental Mutation 'R0709:Med13'
ID 216232
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R0709 (G1)
Quality Score 56
Status Validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86210422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 573 (K573N)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect possibly damaging
Transcript: ENSMUST00000043624
AA Change: K573N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: K573N

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Mnat1 A G 12: 73,234,962 (GRCm39) R204G possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0497:Med13 UTSW 11 86,167,809 (GRCm39) splice site probably benign
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTTCCTGTCCAAAAGGTCCAACTGG -3'
(R):5'- GCCAAAGACTTGTGATCTCTGCTGC -3'

Sequencing Primer
(F):5'- AAGGTCCAACTGGATCATCCTTG -3'
(R):5'- CAAGTGAGGTTTTCAAACATCCG -3'
Posted On 2014-07-31