Incidental Mutation 'R0709:Mnat1'
ID 216235
Institutional Source Beutler Lab
Gene Symbol Mnat1
Ensembl Gene ENSMUSG00000021103
Gene Name menage a trois 1
Synonyms E130115E11Rik, MAT1
MMRRC Submission 038892-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0709 (G1)
Quality Score 41
Status Validated
Chromosome 12
Chromosomal Location 73170491-73320762 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73234962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 204 (R204G)
Ref Sequence ENSEMBL: ENSMUSP00000141036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021523] [ENSMUST00000187549] [ENSMUST00000189644]
AlphaFold P51949
Predicted Effect possibly damaging
Transcript: ENSMUST00000021523
AA Change: R204G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021523
Gene: ENSMUSG00000021103
AA Change: R204G

DomainStartEndE-ValueType
RING 6 49 3.24e-4 SMART
Pfam:MAT1 53 250 2.1e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000187549
AA Change: R204G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141036
Gene: ENSMUSG00000021103
AA Change: R204G

DomainStartEndE-ValueType
RING 6 49 1.6e-6 SMART
Pfam:MAT1 53 238 1.7e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189644
SMART Domains Protein: ENSMUSP00000141146
Gene: ENSMUSG00000021103

DomainStartEndE-ValueType
RING 6 49 1.6e-6 SMART
Pfam:MAT1 53 90 4.2e-14 PFAM
Meta Mutation Damage Score 0.5126 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, along with cyclin H and CDK7, forms the CDK-activating kinase (CAK) enzymatic complex. This complex activates several cyclin-associated kinases and can also associate with TFIIH to activate transcription by RNA polymerase II. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruption of this gene die as embryos at some point between implantation and gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,436,358 (GRCm39) D137V probably damaging Het
Aar2 C T 2: 156,408,930 (GRCm39) P378L probably damaging Het
Abcc5 A T 16: 20,195,342 (GRCm39) H718Q possibly damaging Het
Ace G T 11: 105,872,364 (GRCm39) L319F probably damaging Het
Angpt4 C A 2: 151,776,434 (GRCm39) P321T possibly damaging Het
Atrip T C 9: 108,896,171 (GRCm39) N282S probably benign Het
AW554918 A C 18: 25,596,711 (GRCm39) S525R probably damaging Het
Ccdc136 T A 6: 29,414,969 (GRCm39) I644N possibly damaging Het
Ccdc178 A G 18: 22,200,719 (GRCm39) Y413H probably damaging Het
Ccdc7b A G 8: 129,863,127 (GRCm39) H223R probably benign Het
Cd109 T C 9: 78,579,260 (GRCm39) V634A possibly damaging Het
Col7a1 T A 9: 108,790,616 (GRCm39) probably benign Het
Copb2 A T 9: 98,445,220 (GRCm39) probably benign Het
Csrnp3 C T 2: 65,852,907 (GRCm39) S445L probably damaging Het
Cxcl13 G T 5: 96,106,530 (GRCm39) C34F probably damaging Het
Dars2 T C 1: 160,874,498 (GRCm39) E397G probably benign Het
Dlg5 C T 14: 24,196,323 (GRCm39) V1625M probably damaging Het
Dnah12 T G 14: 26,606,222 (GRCm39) probably benign Het
Eif4a1 C A 11: 69,561,078 (GRCm39) A76S probably damaging Het
Fam162b T A 10: 51,463,347 (GRCm39) I107L probably damaging Het
Fbxo30 G T 10: 11,167,057 (GRCm39) C593F possibly damaging Het
Fut9 A G 4: 25,620,359 (GRCm39) F152L probably damaging Het
Galnt2 G A 8: 125,070,085 (GRCm39) G534D probably benign Het
Gm973 C T 1: 59,597,393 (GRCm39) probably benign Het
Golm2 T A 2: 121,697,906 (GRCm39) V74E probably damaging Het
Gprc5a T A 6: 135,055,948 (GRCm39) S132T probably damaging Het
Hk3 G A 13: 55,162,543 (GRCm39) R47C probably damaging Het
Hrnr A T 3: 93,239,815 (GRCm39) Q3351L unknown Het
Icam1 T A 9: 20,930,423 (GRCm39) F92L probably damaging Het
Ifi213 C T 1: 173,417,366 (GRCm39) V349I possibly damaging Het
Il12rb2 T C 6: 67,275,888 (GRCm39) probably benign Het
Irx3 A G 8: 92,526,048 (GRCm39) V487A possibly damaging Het
Kalrn A G 16: 33,855,924 (GRCm39) V204A probably damaging Het
Krt16 T C 11: 100,137,280 (GRCm39) probably benign Het
Loxhd1 G A 18: 77,492,665 (GRCm39) V1369I probably benign Het
Med13 T A 11: 86,210,422 (GRCm39) K573N possibly damaging Het
Myt1l A T 12: 29,877,732 (GRCm39) D461V unknown Het
Nek6 T A 2: 38,447,858 (GRCm39) S41T probably damaging Het
Nudt22 T C 19: 6,970,874 (GRCm39) E232G probably damaging Het
Numbl C A 7: 26,973,415 (GRCm39) F192L probably damaging Het
Or4c105 C T 2: 88,648,226 (GRCm39) T237I probably benign Het
Or7g12 T A 9: 18,899,422 (GRCm39) I46K probably damaging Het
P2rx4 T C 5: 122,852,467 (GRCm39) V47A probably damaging Het
Phka1 T A X: 101,629,710 (GRCm39) I478F probably damaging Het
Pkn2 G A 3: 142,536,281 (GRCm39) T200I probably damaging Het
Plcg1 T A 2: 160,593,698 (GRCm39) probably null Het
Polg2 C T 11: 106,659,239 (GRCm39) G425R probably damaging Het
Ptprm G T 17: 67,251,327 (GRCm39) probably null Het
Reg1 G A 6: 78,405,101 (GRCm39) R108H possibly damaging Het
Slc19a2 T A 1: 164,084,367 (GRCm39) F86I probably damaging Het
Slc26a11 T C 11: 119,265,603 (GRCm39) L372P probably damaging Het
Slc2a4 C T 11: 69,836,985 (GRCm39) V28M possibly damaging Het
Snap29 A G 16: 17,224,012 (GRCm39) N9S probably damaging Het
Snd1 C G 6: 28,545,469 (GRCm39) probably benign Het
Sorcs3 G A 19: 48,475,845 (GRCm39) A235T probably benign Het
Sp100 T A 1: 85,622,002 (GRCm39) N362K probably damaging Het
Sqor A T 2: 122,641,775 (GRCm39) I32F probably benign Het
Stx6 C T 1: 155,069,040 (GRCm39) R189C probably damaging Het
Tchp T C 5: 114,855,514 (GRCm39) I298T probably damaging Het
Themis A G 10: 28,637,570 (GRCm39) I225V probably benign Het
Timm50 A T 7: 28,006,366 (GRCm39) V245E probably damaging Het
Tnxb A G 17: 34,908,328 (GRCm39) E1327G probably damaging Het
Tpp1 C T 7: 105,398,814 (GRCm39) R205H probably benign Het
Tradd T C 8: 105,987,276 (GRCm39) E10G possibly damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
Ttn T C 2: 76,729,747 (GRCm39) probably benign Het
Ttr A T 18: 20,803,034 (GRCm39) probably null Het
Ubp1 A G 9: 113,773,999 (GRCm39) Y66C probably damaging Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r104 A T 17: 20,263,166 (GRCm39) N98K probably damaging Het
Yipf5 A G 18: 40,340,825 (GRCm39) S176P probably benign Het
Zpbp2 C T 11: 98,444,763 (GRCm39) T97I probably damaging Het
Other mutations in Mnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Mnat1 APN 12 73,319,213 (GRCm39) missense probably benign 0.01
IGL01959:Mnat1 APN 12 73,228,705 (GRCm39) splice site probably benign
IGL02491:Mnat1 APN 12 73,170,682 (GRCm39) missense probably null 0.83
IGL02876:Mnat1 APN 12 73,217,378 (GRCm39) missense probably damaging 0.98
R0312:Mnat1 UTSW 12 73,228,558 (GRCm39) missense possibly damaging 0.92
R0488:Mnat1 UTSW 12 73,217,413 (GRCm39) missense probably damaging 1.00
R0846:Mnat1 UTSW 12 73,170,706 (GRCm39) splice site probably null
R1080:Mnat1 UTSW 12 73,319,292 (GRCm39) missense probably damaging 0.98
R1803:Mnat1 UTSW 12 73,226,007 (GRCm39) nonsense probably null
R2338:Mnat1 UTSW 12 73,265,917 (GRCm39) critical splice donor site probably null
R2516:Mnat1 UTSW 12 73,228,550 (GRCm39) splice site probably benign
R4414:Mnat1 UTSW 12 73,228,601 (GRCm39) missense probably damaging 0.99
R4957:Mnat1 UTSW 12 73,170,652 (GRCm39) missense probably damaging 1.00
R6323:Mnat1 UTSW 12 73,214,878 (GRCm39) missense probably damaging 1.00
R6738:Mnat1 UTSW 12 73,319,246 (GRCm39) missense probably benign 0.00
R6769:Mnat1 UTSW 12 73,319,196 (GRCm39) missense probably benign 0.00
R7002:Mnat1 UTSW 12 73,277,479 (GRCm39) intron probably benign
R7182:Mnat1 UTSW 12 73,277,452 (GRCm39) nonsense probably null
R7887:Mnat1 UTSW 12 73,234,965 (GRCm39) missense probably benign 0.45
R8118:Mnat1 UTSW 12 73,265,864 (GRCm39) missense probably benign
R9311:Mnat1 UTSW 12 73,214,916 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTGGTGGCTAGATGAAATAGGACCCT -3'
(R):5'- CCACTGCTCCACTTTACACCAGTAGAT -3'

Sequencing Primer
(F):5'- AGAGGCCTACTTTGAAAGCG -3'
(R):5'- caagaccctacatctcatctcc -3'
Posted On 2014-07-31