Mutagenetix > Incidental Mutation

Incidental Mutation 'R0709:Ptprm'

216240

Institutional Source

Beutler Lab

Gene Symbol

Ptprm

Ensembl Gene

ENSMUSG00000033278

Gene Name

protein tyrosine phosphatase, receptor type, M

Synonyms

RPTPmu

MMRRC Submission

038892-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0709 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

66666947-67354457 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 66944332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091]

AlphaFold

P28828

Predicted Effect

probably null
Transcript: ENSMUST00000037974

SMART Domains

Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
MAM	22	184	2.81e-73	SMART
IG	191	279	2.1e-6	SMART
FN3	281	364	6.35e-4	SMART
FN3	380	468	2.81e-5	SMART
FN3	482	572	3.7e-5	SMART
transmembrane domain	743	764	N/A	INTRINSIC
low complexity region	765	774	N/A	INTRINSIC
PTPc	899	1156	5.26e-135	SMART
PTPc	1185	1450	9.46e-96	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000223982

Predicted Effect

probably null
Transcript: ENSMUST00000224091

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225688

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.8%

Validation Efficiency

98% (83/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	T	16: 14,618,494	D137V	probably damaging	Het
Aar2	C	T	2: 156,567,010	P378L	probably damaging	Het
Abcc5	A	T	16: 20,376,592	H718Q	possibly damaging	Het
Ace	G	T	11: 105,981,538	L319F	probably damaging	Het
Angpt4	C	A	2: 151,934,514	P321T	possibly damaging	Het
Atrip	T	C	9: 109,067,103	N282S	probably benign	Het
AW554918	A	C	18: 25,463,654	S525R	probably damaging	Het
Casc4	T	A	2: 121,867,425	V74E	probably damaging	Het
Ccdc136	T	A	6: 29,414,970	I644N	possibly damaging	Het
Ccdc178	A	G	18: 22,067,662	Y413H	probably damaging	Het
Ccdc7b	A	G	8: 129,136,646	H223R	probably benign	Het
Cd109	T	C	9: 78,671,978	V634A	possibly damaging	Het
Col7a1	T	A	9: 108,961,548		probably benign	Het
Copb2	A	T	9: 98,563,167		probably benign	Het
Csrnp3	C	T	2: 66,022,563	S445L	probably damaging	Het
Cxcl13	G	T	5: 95,958,671	C34F	probably damaging	Het
Dars2	T	C	1: 161,046,928	E397G	probably benign	Het
Dlg5	C	T	14: 24,146,255	V1625M	probably damaging	Het
Dnah12	T	G	14: 26,884,265		probably benign	Het
Eif4a1	C	A	11: 69,670,252	A76S	probably damaging	Het
Fam162b	T	A	10: 51,587,251	I107L	probably damaging	Het
Fbxo30	G	T	10: 11,291,313	C593F	possibly damaging	Het
Fut9	A	G	4: 25,620,359	F152L	probably damaging	Het
Galnt2	G	A	8: 124,343,346	G534D	probably benign	Het
Gm973	C	T	1: 59,558,234		probably benign	Het
Gprc5a	T	A	6: 135,078,950	S132T	probably damaging	Het
Hk3	G	A	13: 55,014,730	R47C	probably damaging	Het
Hrnr	A	T	3: 93,332,508	Q3351L	unknown	Het
Icam1	T	A	9: 21,019,127	F92L	probably damaging	Het
Ifi213	C	T	1: 173,589,800	V349I	possibly damaging	Het
Il12rb2	T	C	6: 67,298,904		probably benign	Het
Irx3	A	G	8: 91,799,420	V487A	possibly damaging	Het
Kalrn	A	G	16: 34,035,554	V204A	probably damaging	Het
Krt16	T	C	11: 100,246,454		probably benign	Het
Loxhd1	G	A	18: 77,404,969	V1369I	probably benign	Het
Med13	T	A	11: 86,319,596	K573N	possibly damaging	Het
Mnat1	A	G	12: 73,188,188	R204G	possibly damaging	Het
Myt1l	A	T	12: 29,827,733	D461V	unknown	Het
Nek6	T	A	2: 38,557,846	S41T	probably damaging	Het
Nudt22	T	C	19: 6,993,506	E232G	probably damaging	Het
Numbl	C	A	7: 27,273,990	F192L	probably damaging	Het
Olfr1202	C	T	2: 88,817,882	T237I	probably benign	Het
Olfr834	T	A	9: 18,988,126	I46K	probably damaging	Het
P2rx4	T	C	5: 122,714,404	V47A	probably damaging	Het
Phka1	T	A	X: 102,586,104	I478F	probably damaging	Het
Pkn2	G	A	3: 142,830,520	T200I	probably damaging	Het
Plcg1	T	A	2: 160,751,778		probably null	Het
Polg2	C	T	11: 106,768,413	G425R	probably damaging	Het
Reg1	G	A	6: 78,428,118	R108H	possibly damaging	Het
Slc19a2	T	A	1: 164,256,798	F86I	probably damaging	Het
Slc26a11	T	C	11: 119,374,777	L372P	probably damaging	Het
Slc2a4	C	T	11: 69,946,159	V28M	possibly damaging	Het
Snap29	A	G	16: 17,406,148	N9S	probably damaging	Het
Snd1	C	G	6: 28,545,470		probably benign	Het
Sorcs3	G	A	19: 48,487,406	A235T	probably benign	Het
Sp100	T	A	1: 85,694,281	N362K	probably damaging	Het
Sqor	A	T	2: 122,799,855	I32F	probably benign	Het
Stx6	C	T	1: 155,193,294	R189C	probably damaging	Het
Tchp	T	C	5: 114,717,453	I298T	probably damaging	Het
Themis	A	G	10: 28,761,574	I225V	probably benign	Het
Timm50	A	T	7: 28,306,941	V245E	probably damaging	Het
Tnxb	A	G	17: 34,689,354	E1327G	probably damaging	Het
Tpp1	C	T	7: 105,749,607	R205H	probably benign	Het
Tradd	T	C	8: 105,260,644	E10G	possibly damaging	Het
Trim43a	G	A	9: 88,582,146	E37K	probably benign	Het
Ttn	T	C	2: 76,899,403		probably benign	Het
Ttr	A	T	18: 20,669,977		probably null	Het
Ubp1	A	G	9: 113,944,931	Y66C	probably damaging	Het
Vmn2r102	A	T	17: 19,677,619	M299L	probably benign	Het
Vmn2r104	A	T	17: 20,042,904	N98K	probably damaging	Het
Yipf5	A	G	18: 40,207,772	S176P	probably benign	Het
Zpbp2	C	T	11: 98,553,937	T97I	probably damaging	Het

Other mutations in Ptprm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Ptprm	APN	17	66817972	missense	probably damaging	1.00
IGL01128:Ptprm	APN	17	67042101	missense	probably damaging	1.00
IGL01509:Ptprm	APN	17	66762213	missense	possibly damaging	0.95
IGL01785:Ptprm	APN	17	66685623	missense	probably damaging	1.00
IGL01912:Ptprm	APN	17	67046118	missense	probably benign	0.13
IGL01929:Ptprm	APN	17	66690549	missense	probably damaging	1.00
IGL01937:Ptprm	APN	17	67046163	splice site	probably benign
IGL01939:Ptprm	APN	17	67063163	splice site	probably benign
IGL02053:Ptprm	APN	17	66693841	missense	probably damaging	1.00
IGL02203:Ptprm	APN	17	66953123	missense	probably damaging	1.00
IGL02468:Ptprm	APN	17	66814509	missense	probably benign	0.02
IGL02500:Ptprm	APN	17	66920048	missense	probably damaging	0.99
IGL02542:Ptprm	APN	17	66920150	missense	probably benign
Becalming	UTSW	17	66944332	splice site	probably null
Pacifying	UTSW	17	66683408	missense	possibly damaging	0.74
R0674:Ptprm	UTSW	17	67191341	missense	possibly damaging	0.52
R1054:Ptprm	UTSW	17	67042318	missense	probably damaging	1.00
R1522:Ptprm	UTSW	17	66693871	missense	possibly damaging	0.91
R1561:Ptprm	UTSW	17	66940541	missense	probably damaging	1.00
R1726:Ptprm	UTSW	17	67042327	missense	probably damaging	1.00
R1744:Ptprm	UTSW	17	66689366	missense	probably damaging	1.00
R1873:Ptprm	UTSW	17	66688355	missense	probably damaging	1.00
R1951:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1952:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1953:Ptprm	UTSW	17	66940580	missense	probably benign	0.07
R1993:Ptprm	UTSW	17	66747160	missense	probably damaging	1.00
R2017:Ptprm	UTSW	17	66957153	splice site	probably null
R2266:Ptprm	UTSW	17	66725851	splice site	probably null
R2417:Ptprm	UTSW	17	66944326	missense	probably damaging	0.97
R2511:Ptprm	UTSW	17	66693778	missense	probably damaging	1.00
R3726:Ptprm	UTSW	17	66956860	missense	possibly damaging	0.91
R3824:Ptprm	UTSW	17	66809575	missense	probably benign	0.40
R4057:Ptprm	UTSW	17	67075663	missense	possibly damaging	0.93
R4113:Ptprm	UTSW	17	66725813	missense	probably damaging	1.00
R4559:Ptprm	UTSW	17	66683408	missense	possibly damaging	0.74
R4598:Ptprm	UTSW	17	67095497	missense	probably benign	0.00
R4742:Ptprm	UTSW	17	66744751	nonsense	probably null
R4974:Ptprm	UTSW	17	66678067	missense	probably benign	0.01
R5157:Ptprm	UTSW	17	66957097	missense	probably benign	0.09
R5433:Ptprm	UTSW	17	66693473	missense	probably damaging	1.00
R5509:Ptprm	UTSW	17	66689358	missense	probably damaging	1.00
R5586:Ptprm	UTSW	17	66920196	missense	probably damaging	1.00
R5820:Ptprm	UTSW	17	66689465	missense	probably damaging	1.00
R5867:Ptprm	UTSW	17	67045981	splice site	probably null
R6044:Ptprm	UTSW	17	66693862	missense	probably damaging	1.00
R6229:Ptprm	UTSW	17	66688300	missense	probably damaging	1.00
R6615:Ptprm	UTSW	17	67353956	critical splice donor site	probably null
R6969:Ptprm	UTSW	17	66912418	missense	possibly damaging	0.63
R7135:Ptprm	UTSW	17	66944288	missense	possibly damaging	0.93
R7161:Ptprm	UTSW	17	66809627	missense	probably benign	0.21
R7410:Ptprm	UTSW	17	66693566	missense	probably damaging	0.99
R7476:Ptprm	UTSW	17	66725791	missense	probably benign	0.01
R7789:Ptprm	UTSW	17	67095539	missense	probably damaging	1.00
R8027:Ptprm	UTSW	17	66944205	missense	probably damaging	1.00
R8089:Ptprm	UTSW	17	66683488	missense	possibly damaging	0.63
R8442:Ptprm	UTSW	17	66944317	missense	possibly damaging	0.70
R8476:Ptprm	UTSW	17	66944322	missense	probably damaging	1.00
R8866:Ptprm	UTSW	17	66809635	missense	probably benign	0.00
R8907:Ptprm	UTSW	17	66744737	missense	probably damaging	0.99
R8930:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R8932:Ptprm	UTSW	17	66956851	missense	probably benign	0.03
R9009:Ptprm	UTSW	17	66689359	missense	probably damaging	1.00
R9084:Ptprm	UTSW	17	66956953	missense	possibly damaging	0.93
R9338:Ptprm	UTSW	17	66762148	missense	probably damaging	1.00
R9514:Ptprm	UTSW	17	66809471	missense	probably damaging	1.00
R9610:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9611:Ptprm	UTSW	17	66693488	missense	probably damaging	1.00
R9620:Ptprm	UTSW	17	66809489	missense	probably damaging	1.00
R9663:Ptprm	UTSW	17	67191296	missense	probably benign	0.34
R9694:Ptprm	UTSW	17	66809489	missense	probably damaging	1.00
R9736:Ptprm	UTSW	17	66690567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCGCTTCTGATGCAAGGCATAAC -3'
(R):5'- GGTGGAAACAGTTCAATGCGGC -3'

Sequencing Primer
(F):5'- TGCAAGGCATAACTCATCAGTG -3'
(R):5'- CAGGTTGTGGTAAACACATCC -3'

Posted On

2014-07-31