Incidental Mutation 'R0606:Tln1'
ID 216250
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Name talin 1
Synonyms
MMRRC Submission 038795-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0606 (G1)
Quality Score 24
Status Validated
Chromosome 4
Chromosomal Location 43531513-43562583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43547756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 735 (Q735R)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
AlphaFold P26039
PDB Structure Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
NMR structure of the talin rod domain, 1655-1822 [SOLUTION NMR]
>> 16 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: Q735R

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: Q735R

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Meta Mutation Damage Score 0.5560 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,572 (GRCm39) Y211H probably damaging Het
Actn1 A T 12: 80,221,421 (GRCm39) probably benign Het
Adtrp A G 13: 41,920,881 (GRCm39) F197L probably damaging Het
Ankrd11 G A 8: 123,619,571 (GRCm39) T1406I probably benign Het
Arhgap24 A T 5: 103,045,086 (GRCm39) R620W probably damaging Het
Atg13 A G 2: 91,512,418 (GRCm39) Y284H probably benign Het
Atrn A G 2: 130,748,776 (GRCm39) E99G possibly damaging Het
Cage1 A T 13: 38,200,470 (GRCm39) probably benign Het
Cblif A T 19: 11,729,658 (GRCm39) I206F possibly damaging Het
Ccr3 T A 9: 123,828,839 (GRCm39) M58K probably benign Het
Cdk18 G T 1: 132,045,355 (GRCm39) probably benign Het
Chst5 A G 8: 112,617,551 (GRCm39) V23A probably benign Het
Col4a3 T C 1: 82,650,307 (GRCm39) probably benign Het
Col4a6 A G X: 139,975,219 (GRCm39) probably benign Het
Csmd3 T C 15: 48,321,058 (GRCm39) I251V probably benign Het
Csnk1g3 G A 18: 54,050,100 (GRCm39) V115M probably damaging Het
Cst7 A T 2: 150,412,439 (GRCm39) M1L probably benign Het
Cyp4f17 A T 17: 32,746,817 (GRCm39) D373V probably damaging Het
Dclk2 G A 3: 86,813,311 (GRCm39) R212W probably damaging Het
Dhrs7b T G 11: 60,721,572 (GRCm39) probably benign Het
Dhx58 T A 11: 100,593,077 (GRCm39) H210L probably benign Het
Dnah9 T C 11: 65,732,159 (GRCm39) Y4249C probably damaging Het
Eif5b T A 1: 38,087,974 (GRCm39) L990H probably damaging Het
Faap24 T C 7: 35,094,388 (GRCm39) probably benign Het
Fryl T A 5: 73,282,077 (GRCm39) H174L probably benign Het
Gabrr1 T C 4: 33,132,696 (GRCm39) W15R probably benign Het
Gm15446 T C 5: 110,091,347 (GRCm39) V533A probably benign Het
Gm6760 T A X: 63,195,259 (GRCm39) K63* probably null Het
Gne C T 4: 44,042,244 (GRCm39) E444K possibly damaging Het
Gpr173 T A X: 151,130,036 (GRCm39) M146L possibly damaging Het
Hira C T 16: 18,753,797 (GRCm39) S547L probably benign Het
Hnf1b A G 11: 83,754,810 (GRCm39) H161R probably benign Het
Hnrnpm T A 17: 33,877,364 (GRCm39) N53I probably damaging Het
Hs3st5 A T 10: 36,708,584 (GRCm39) I40F probably benign Het
Hydin C T 8: 111,276,430 (GRCm39) probably benign Het
Ift172 A G 5: 31,411,657 (GRCm39) I1607T probably damaging Het
Igfn1 T C 1: 135,887,639 (GRCm39) Q2475R probably damaging Het
Il6st T C 13: 112,640,806 (GRCm39) S800P possibly damaging Het
Iqub G A 6: 24,501,260 (GRCm39) probably benign Het
Itgb1 A T 8: 129,448,853 (GRCm39) probably benign Het
Kctd21 G A 7: 96,996,808 (GRCm39) E94K probably benign Het
Kir3dl2 A G X: 135,354,260 (GRCm39) V233A possibly damaging Het
Klra2 A T 6: 131,197,187 (GRCm39) C271S probably damaging Het
Lacc1 A T 14: 77,267,061 (GRCm39) C401S probably damaging Het
Lmna T C 3: 88,389,885 (GRCm39) E580G probably damaging Het
Matn2 A G 15: 34,345,296 (GRCm39) Y101C probably damaging Het
Mrps16 G A 14: 20,441,457 (GRCm39) R116* probably null Het
Ndrg2 G T 14: 52,143,674 (GRCm39) R333S probably damaging Het
Nf2 A G 11: 4,732,194 (GRCm39) I507T possibly damaging Het
Nktr A G 9: 121,578,356 (GRCm39) probably benign Het
Nkx3-1 G A 14: 69,428,455 (GRCm39) probably benign Het
Npat T C 9: 53,467,781 (GRCm39) probably null Het
Nrxn1 T C 17: 90,872,801 (GRCm39) N1047S probably damaging Het
Nup210 A T 6: 91,003,911 (GRCm39) I1402N possibly damaging Het
Or5d40 G T 2: 88,015,624 (GRCm39) M134I possibly damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pdcl2 C T 5: 76,460,328 (GRCm39) S182N probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pla2g4a A G 1: 149,716,455 (GRCm39) F669L probably benign Het
Plekha8 A G 6: 54,606,805 (GRCm39) K367E probably damaging Het
Pola1 A G X: 92,531,693 (GRCm39) probably benign Het
Ppm1d C T 11: 85,236,703 (GRCm39) T494I probably benign Het
Pramel16 T A 4: 143,676,453 (GRCm39) Y217F probably benign Het
Prl6a1 A T 13: 27,498,177 (GRCm39) probably benign Het
Ptprg T A 14: 12,154,131 (GRCm38) S617R probably benign Het
R3hdm2 G A 10: 127,280,313 (GRCm39) G45D probably damaging Het
Rev1 T A 1: 38,098,204 (GRCm39) R780W probably null Het
Rnf139 T A 15: 58,771,676 (GRCm39) F567Y probably damaging Het
Scarf1 T C 11: 75,405,174 (GRCm39) V71A probably damaging Het
Shtn1 A G 19: 58,988,372 (GRCm39) S438P probably damaging Het
Slc30a3 T A 5: 31,246,067 (GRCm39) H221L probably benign Het
Smo A C 6: 29,753,603 (GRCm39) I160L possibly damaging Het
Snapc5 A T 9: 64,086,582 (GRCm39) probably benign Het
Snf8 G T 11: 95,925,799 (GRCm39) probably benign Het
Spata31d1a T C 13: 59,850,245 (GRCm39) S628G probably benign Het
Sphkap A T 1: 83,258,145 (GRCm39) D199E probably damaging Het
Spring1 T C 5: 118,397,154 (GRCm39) Y128H probably damaging Het
Stxbp5l T C 16: 37,024,883 (GRCm39) T572A possibly damaging Het
Thada C A 17: 84,723,731 (GRCm39) V1108L possibly damaging Het
Trim24 G A 6: 37,848,169 (GRCm39) E42K probably benign Het
Trnt1 T A 6: 106,754,869 (GRCm39) probably benign Het
Ttbk2 A T 2: 120,604,353 (GRCm39) M215K probably damaging Het
Ttc8 C T 12: 98,909,718 (GRCm39) probably benign Het
Ube3c A G 5: 29,795,926 (GRCm39) Y105C probably damaging Het
Unc13c A G 9: 73,438,265 (GRCm39) probably benign Het
Usp36 A G 11: 118,153,854 (GRCm39) probably benign Het
Vcf2 C T X: 149,181,360 (GRCm39) A144T probably benign Het
Vmn2r102 T C 17: 19,899,106 (GRCm39) S483P possibly damaging Het
Wdr95 A G 5: 149,511,595 (GRCm39) T432A probably damaging Het
Wnk1 G T 6: 119,903,644 (GRCm39) P2523H probably damaging Het
Xpo4 A G 14: 57,875,665 (GRCm39) probably benign Het
Zar1 G T 5: 72,737,886 (GRCm39) P71Q probably damaging Het
Zbtb41 T C 1: 139,351,348 (GRCm39) Y154H probably benign Het
Zer1 G T 2: 29,994,809 (GRCm39) probably benign Het
Zfp454 A G 11: 50,765,012 (GRCm39) F140S probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43,542,719 (GRCm39) missense probably benign 0.22
IGL00987:Tln1 APN 4 43,551,297 (GRCm39) unclassified probably benign
IGL01345:Tln1 APN 4 43,536,281 (GRCm39) missense probably damaging 1.00
IGL01456:Tln1 APN 4 43,543,432 (GRCm39) unclassified probably benign
IGL01715:Tln1 APN 4 43,555,890 (GRCm39) missense probably damaging 1.00
IGL01750:Tln1 APN 4 43,545,435 (GRCm39) missense probably damaging 1.00
IGL01933:Tln1 APN 4 43,555,894 (GRCm39) missense possibly damaging 0.52
IGL01933:Tln1 APN 4 43,539,508 (GRCm39) missense probably benign
IGL02119:Tln1 APN 4 43,546,760 (GRCm39) missense probably damaging 0.99
IGL02148:Tln1 APN 4 43,555,388 (GRCm39) missense probably damaging 1.00
IGL02153:Tln1 APN 4 43,546,857 (GRCm39) missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43,540,612 (GRCm39) missense probably benign 0.07
IGL02691:Tln1 APN 4 43,539,544 (GRCm39) missense probably benign 0.42
IGL02882:Tln1 APN 4 43,539,522 (GRCm39) missense probably benign 0.45
IGL02892:Tln1 APN 4 43,555,679 (GRCm39) missense probably damaging 1.00
IGL03061:Tln1 APN 4 43,545,694 (GRCm39) missense probably damaging 1.00
IGL03102:Tln1 APN 4 43,532,861 (GRCm39) missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43,539,084 (GRCm39) splice site probably benign
H8786:Tln1 UTSW 4 43,544,589 (GRCm39) missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43,539,998 (GRCm39) missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43,542,701 (GRCm39) critical splice donor site probably null
R0206:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0208:Tln1 UTSW 4 43,549,151 (GRCm39) missense probably damaging 1.00
R0454:Tln1 UTSW 4 43,553,504 (GRCm39) missense probably benign
R0539:Tln1 UTSW 4 43,543,434 (GRCm39) critical splice donor site probably null
R0548:Tln1 UTSW 4 43,542,709 (GRCm39) missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43,550,304 (GRCm39) missense possibly damaging 0.94
R0607:Tln1 UTSW 4 43,553,071 (GRCm39) missense probably damaging 1.00
R0609:Tln1 UTSW 4 43,544,645 (GRCm39) missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43,555,333 (GRCm39) missense probably damaging 1.00
R0993:Tln1 UTSW 4 43,549,825 (GRCm39) missense probably benign 0.22
R1255:Tln1 UTSW 4 43,538,044 (GRCm39) missense probably damaging 1.00
R1292:Tln1 UTSW 4 43,534,578 (GRCm39) critical splice donor site probably null
R1752:Tln1 UTSW 4 43,536,311 (GRCm39) missense probably damaging 1.00
R2169:Tln1 UTSW 4 43,548,005 (GRCm39) missense probably damaging 1.00
R2172:Tln1 UTSW 4 43,545,721 (GRCm39) missense probably benign
R2202:Tln1 UTSW 4 43,553,083 (GRCm39) splice site probably null
R2680:Tln1 UTSW 4 43,539,668 (GRCm39) missense probably damaging 1.00
R3012:Tln1 UTSW 4 43,542,525 (GRCm39) missense probably benign
R3714:Tln1 UTSW 4 43,540,597 (GRCm39) missense probably damaging 1.00
R3735:Tln1 UTSW 4 43,549,370 (GRCm39) missense probably damaging 0.97
R3794:Tln1 UTSW 4 43,536,295 (GRCm39) missense probably damaging 1.00
R3825:Tln1 UTSW 4 43,536,413 (GRCm39) splice site probably benign
R3983:Tln1 UTSW 4 43,553,030 (GRCm39) missense probably damaging 1.00
R4061:Tln1 UTSW 4 43,549,177 (GRCm39) missense probably damaging 1.00
R4249:Tln1 UTSW 4 43,536,104 (GRCm39) missense probably damaging 1.00
R4287:Tln1 UTSW 4 43,543,509 (GRCm39) missense probably benign 0.01
R4471:Tln1 UTSW 4 43,551,018 (GRCm39) missense probably benign 0.03
R4562:Tln1 UTSW 4 43,533,598 (GRCm39) missense probably damaging 1.00
R4654:Tln1 UTSW 4 43,535,954 (GRCm39) missense probably null 1.00
R4737:Tln1 UTSW 4 43,540,588 (GRCm39) missense probably benign 0.00
R4936:Tln1 UTSW 4 43,547,522 (GRCm39) missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43,539,406 (GRCm39) missense probably benign 0.06
R5288:Tln1 UTSW 4 43,540,661 (GRCm39) missense probably benign 0.06
R5421:Tln1 UTSW 4 43,533,609 (GRCm39) missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43,543,905 (GRCm39) missense probably benign 0.26
R5660:Tln1 UTSW 4 43,547,732 (GRCm39) missense probably damaging 1.00
R5772:Tln1 UTSW 4 43,545,191 (GRCm39) missense probably benign 0.13
R6012:Tln1 UTSW 4 43,539,508 (GRCm39) missense probably benign
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6038:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6039:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6052:Tln1 UTSW 4 43,555,052 (GRCm39) missense probably damaging 0.99
R6145:Tln1 UTSW 4 43,538,030 (GRCm39) missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43,534,744 (GRCm39) missense probably benign 0.06
R6242:Tln1 UTSW 4 43,533,145 (GRCm39) missense probably damaging 1.00
R6454:Tln1 UTSW 4 43,533,866 (GRCm39) missense probably damaging 0.99
R6467:Tln1 UTSW 4 43,543,165 (GRCm39) missense probably benign 0.42
R6548:Tln1 UTSW 4 43,547,525 (GRCm39) missense probably damaging 0.98
R6576:Tln1 UTSW 4 43,555,419 (GRCm39) splice site probably null
R6722:Tln1 UTSW 4 43,547,618 (GRCm39) missense probably damaging 1.00
R6968:Tln1 UTSW 4 43,550,217 (GRCm39) missense probably benign 0.02
R7000:Tln1 UTSW 4 43,556,302 (GRCm39) missense probably damaging 0.96
R7137:Tln1 UTSW 4 43,540,616 (GRCm39) missense probably damaging 1.00
R7242:Tln1 UTSW 4 43,542,602 (GRCm39) missense probably benign 0.01
R7294:Tln1 UTSW 4 43,534,399 (GRCm39) missense probably benign 0.02
R7312:Tln1 UTSW 4 43,545,922 (GRCm39) missense probably damaging 1.00
R7547:Tln1 UTSW 4 43,545,206 (GRCm39) missense possibly damaging 0.80
R7836:Tln1 UTSW 4 43,554,309 (GRCm39) missense probably benign 0.01
R7874:Tln1 UTSW 4 43,555,606 (GRCm39) missense probably damaging 1.00
R7874:Tln1 UTSW 4 43,538,041 (GRCm39) missense probably damaging 1.00
R8030:Tln1 UTSW 4 43,535,737 (GRCm39) critical splice donor site probably null
R8105:Tln1 UTSW 4 43,538,231 (GRCm39) missense probably benign 0.32
R8212:Tln1 UTSW 4 43,555,918 (GRCm39) missense probably damaging 1.00
R8416:Tln1 UTSW 4 43,540,116 (GRCm39) missense probably benign 0.01
R8419:Tln1 UTSW 4 43,536,397 (GRCm39) missense probably damaging 1.00
R8680:Tln1 UTSW 4 43,553,041 (GRCm39) missense possibly damaging 0.52
R8708:Tln1 UTSW 4 43,534,769 (GRCm39) splice site probably benign
R8725:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8727:Tln1 UTSW 4 43,555,911 (GRCm39) missense possibly damaging 0.94
R8830:Tln1 UTSW 4 43,556,383 (GRCm39) missense probably benign
R8865:Tln1 UTSW 4 43,538,281 (GRCm39) missense possibly damaging 0.93
R9049:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9050:Tln1 UTSW 4 43,549,786 (GRCm39) nonsense probably null
R9145:Tln1 UTSW 4 43,536,024 (GRCm39) missense probably damaging 1.00
R9210:Tln1 UTSW 4 43,536,119 (GRCm39) missense probably damaging 1.00
R9337:Tln1 UTSW 4 43,532,927 (GRCm39) missense probably damaging 1.00
R9346:Tln1 UTSW 4 43,546,895 (GRCm39) missense probably damaging 0.97
R9358:Tln1 UTSW 4 43,532,084 (GRCm39) missense possibly damaging 0.68
R9487:Tln1 UTSW 4 43,542,893 (GRCm39) missense probably damaging 1.00
R9631:Tln1 UTSW 4 43,545,694 (GRCm39) missense probably damaging 1.00
R9650:Tln1 UTSW 4 43,545,912 (GRCm39) missense probably damaging 1.00
R9666:Tln1 UTSW 4 43,542,957 (GRCm39) missense probably damaging 0.96
RF021:Tln1 UTSW 4 43,555,890 (GRCm39) missense probably damaging 1.00
X0052:Tln1 UTSW 4 43,533,125 (GRCm39) critical splice donor site probably null
X0063:Tln1 UTSW 4 43,548,015 (GRCm39) nonsense probably null
Z1176:Tln1 UTSW 4 43,543,211 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGAAAGGCCACTGTGCTGATCCTC -3'
(R):5'- AGCTACGCAATGTGCTCTGTCC -3'

Sequencing Primer
(F):5'- ATCAGTGGCTTGGTCATACC -3'
(R):5'- TGTACCAAGGTGAGCCCAG -3'
Posted On 2014-07-31