Incidental Mutation 'R1942:Clasp1'
ID216260
Institutional Source Beutler Lab
Gene Symbol Clasp1
Ensembl Gene ENSMUSG00000064302
Gene NameCLIP associating protein 1
Synonyms1700030C23Rik, B130045P17Rik, CLASP1, mCLASP1, 5730583A19Rik, CLASP1alpha
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location118389058-118612678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118501348 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 329 (E329G)
Ref Sequence ENSEMBL: ENSMUSP00000128089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049404] [ENSMUST00000070989] [ENSMUST00000165223] [ENSMUST00000178710] [ENSMUST00000185405] [ENSMUST00000186349] [ENSMUST00000187713] [ENSMUST00000188710] [ENSMUST00000189262] [ENSMUST00000189570] [ENSMUST00000189738] [ENSMUST00000190571] [ENSMUST00000190733] [ENSMUST00000191445] [ENSMUST00000191823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049404
AA Change: E329G

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042266
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070989
AA Change: E329G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067858
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 3.23e-1 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 4.96e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165223
AA Change: E329G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128089
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1056 3.23e-1 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 4.96e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178710
AA Change: E329G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137137
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1047 6.55e-2 SMART
low complexity region 1058 1075 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
TOG 1210 1448 4.96e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185405
AA Change: E329G

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139619
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 769 783 N/A INTRINSIC
low complexity region 801 811 N/A INTRINSIC
TOG 827 1065 1.6e-5 SMART
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1166 1177 N/A INTRINSIC
TOG 1228 1466 2.3e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186349
AA Change: E329G

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141105
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187713
AA Change: E329G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139526
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 768 782 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
TOG 826 1064 1.6e-5 SMART
low complexity region 1075 1092 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
TOG 1227 1465 2.3e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188710
AA Change: E329G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140593
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 818 832 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 1.6e-5 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 2.3e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189262
AA Change: E329G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140860
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
TOG 802 1040 1.6e-5 SMART
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
TOG 1203 1441 2.3e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189570
AA Change: E329G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140167
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1055 3.2e-6 SMART
low complexity region 1066 1083 N/A INTRINSIC
low complexity region 1156 1167 N/A INTRINSIC
TOG 1218 1456 2.3e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189676
Predicted Effect possibly damaging
Transcript: ENSMUST00000189738
AA Change: E329G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140665
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1048 3.23e-1 SMART
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
TOG 1211 1449 4.96e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190135
Predicted Effect possibly damaging
Transcript: ENSMUST00000190571
AA Change: E329G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140019
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
low complexity region 805 819 N/A INTRINSIC
low complexity region 837 847 N/A INTRINSIC
TOG 863 1101 1.6e-5 SMART
low complexity region 1112 1129 N/A INTRINSIC
low complexity region 1150 1163 N/A INTRINSIC
low complexity region 1241 1252 N/A INTRINSIC
TOG 1303 1541 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190733
Predicted Effect possibly damaging
Transcript: ENSMUST00000191445
AA Change: E329G

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140095
Gene: ENSMUSG00000064302
AA Change: E329G

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 761 775 N/A INTRINSIC
low complexity region 793 803 N/A INTRINSIC
TOG 819 1056 3.2e-6 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 2.3e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191823
AA Change: E97G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142203
Gene: ENSMUSG00000064302
AA Change: E97G

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
TOG 87 319 5.6e-16 SMART
low complexity region 347 362 N/A INTRINSIC
low complexity region 374 401 N/A INTRINSIC
low complexity region 450 483 N/A INTRINSIC
low complexity region 537 551 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
TOG 594 832 1.6e-5 SMART
low complexity region 843 860 N/A INTRINSIC
low complexity region 933 944 N/A INTRINSIC
TOG 995 1233 2.4e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204886
Predicted Effect unknown
Transcript: ENSMUST00000204904
AA Change: E114G
Meta Mutation Damage Score 0.4507 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Clasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01786:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01871:Clasp1 APN 1 118570889 missense probably damaging 1.00
IGL02066:Clasp1 APN 1 118565260 critical splice donor site probably null
IGL02602:Clasp1 APN 1 118471785 missense probably damaging 0.99
IGL02683:Clasp1 APN 1 118539266 missense probably benign 0.33
IGL02728:Clasp1 APN 1 118602377 missense probably damaging 1.00
IGL02820:Clasp1 APN 1 118551104 missense possibly damaging 0.77
IGL02874:Clasp1 APN 1 118552043 missense possibly damaging 0.86
IGL02975:Clasp1 APN 1 118462547 missense probably damaging 1.00
IGL03100:Clasp1 APN 1 118467896 missense possibly damaging 0.79
IGL03115:Clasp1 APN 1 118501323 nonsense probably null
IGL03122:Clasp1 APN 1 118510277 missense probably damaging 1.00
IGL03180:Clasp1 APN 1 118505525 missense probably benign 0.33
IGL03248:Clasp1 APN 1 118602476 missense probably benign 0.01
IGL03388:Clasp1 APN 1 118505503 missense possibly damaging 0.95
F5770:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
I2288:Clasp1 UTSW 1 118565229 missense probably benign 0.09
PIT4585001:Clasp1 UTSW 1 118462555 missense probably damaging 0.99
R0079:Clasp1 UTSW 1 118543304 missense probably damaging 1.00
R0395:Clasp1 UTSW 1 118539331 missense possibly damaging 0.48
R0960:Clasp1 UTSW 1 118552026 missense probably benign 0.39
R1448:Clasp1 UTSW 1 118508916 missense probably benign 0.01
R1497:Clasp1 UTSW 1 118552058 missense probably benign 0.42
R1607:Clasp1 UTSW 1 118504959 missense probably damaging 0.98
R1722:Clasp1 UTSW 1 118590464 missense probably damaging 1.00
R1758:Clasp1 UTSW 1 118548025 missense probably damaging 1.00
R1765:Clasp1 UTSW 1 118505531 missense probably damaging 0.99
R1855:Clasp1 UTSW 1 118508894 missense probably damaging 1.00
R1861:Clasp1 UTSW 1 118570931 missense possibly damaging 0.93
R1874:Clasp1 UTSW 1 118600585 critical splice donor site probably null
R2025:Clasp1 UTSW 1 118504899 missense probably damaging 1.00
R2174:Clasp1 UTSW 1 118560095 missense probably damaging 1.00
R2280:Clasp1 UTSW 1 118565183 missense probably benign 0.05
R2288:Clasp1 UTSW 1 118578878 missense probably benign
R2895:Clasp1 UTSW 1 118459838 missense probably damaging 1.00
R3958:Clasp1 UTSW 1 118467881 missense probably damaging 0.99
R4073:Clasp1 UTSW 1 118503848 missense probably damaging 1.00
R4206:Clasp1 UTSW 1 118578906 missense probably damaging 1.00
R4465:Clasp1 UTSW 1 118561078 missense probably damaging 1.00
R4609:Clasp1 UTSW 1 118503035 intron probably benign
R4679:Clasp1 UTSW 1 118543271 missense probably damaging 0.99
R4707:Clasp1 UTSW 1 118543197 nonsense probably null
R4809:Clasp1 UTSW 1 118461250 missense probably benign 0.00
R4906:Clasp1 UTSW 1 118508910 nonsense probably null
R5048:Clasp1 UTSW 1 118547610 intron probably benign
R5298:Clasp1 UTSW 1 118547920 missense possibly damaging 0.71
R5485:Clasp1 UTSW 1 118467913 missense possibly damaging 0.95
R5516:Clasp1 UTSW 1 118497721 missense probably damaging 1.00
R5821:Clasp1 UTSW 1 118590484 missense probably damaging 1.00
R5911:Clasp1 UTSW 1 118506908 unclassified probably benign
R6092:Clasp1 UTSW 1 118510298 missense probably damaging 0.97
R6181:Clasp1 UTSW 1 118419817 missense probably benign 0.18
R6478:Clasp1 UTSW 1 118512180 nonsense probably null
R7090:Clasp1 UTSW 1 118482086 missense probably benign 0.45
R7216:Clasp1 UTSW 1 118547918 missense probably benign 0.00
R7508:Clasp1 UTSW 1 118545434 missense probably benign 0.30
R7541:Clasp1 UTSW 1 118542997 intron probably null
R7644:Clasp1 UTSW 1 118512750 intron probably null
R7825:Clasp1 UTSW 1 118545393 missense probably benign 0.00
R7910:Clasp1 UTSW 1 118602414 nonsense probably null
R7991:Clasp1 UTSW 1 118602414 nonsense probably null
R8074:Clasp1 UTSW 1 118462483 missense probably benign
V7581:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
X0028:Clasp1 UTSW 1 118551125 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTTCCAAGTGGCAGCAAAG -3'
(R):5'- TTCACTGTGAACAACAAAGAAAGTG -3'

Sequencing Primer
(F):5'- GGCTATCAGGCCCACTAAGATG -3'
(R):5'- ACAACAAAGAAAGTGAAGCAATTTAC -3'
Posted On2014-08-01